Description :
From Genome Similarity Track
Location :
Scaffold_271:1732- 5328
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20075hypothetical protein

Sequence
3596 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGGTCTATCGCGTATGAAGTTCGTTGAATAC
AGGATGGAGTAGCTCACTTGGTATTGTCTACAATTAGCAGAAAACACGAAACAAGTACCGGCAAGTCTGTGTTTTGTTTTCATCGGTGACAGTTCCTAAT
GTTATGTGCTATAATGGAATGCTAGAGACCTATGCGCGTACCTGTTATTTTCATGCACACAATGCTTCTCCCTTTTCGACACACGATGTTTATAAGATCA
TTTATGAGGAGAAAATGGCTCCGATCGACTATATTTATCCGCGATGGCTACTGGAAGCAGACGTGAAACGACCTGGGGATGATGAGGTAAGCATCGGCGA
GTCGAGTCTGGCTCTGGATTTTGCATTCATATTTTAAACATGAGATAGACAGATCACGCAGTTCGAAATGGGTCTACTAAGTGAAAAGCTGTCATGGAGA
TTGCAGGTCTCGCTTTGGAGATTATAAGCGCCTAAAGGGATAAGGCGTATCTAGAAATGGCAGATGCGTTACGTAGATTCAAGAAGTGTGCAAGTAAAGG
GATTATTCCGGCCCTCGAAAAATTCAAGAGAAAGCGAACATTATGCACTTCAGCCTTGCACAACGGTAGACGTCGACTCTGACGACACGGCAGCAGACCC
GACAGTGCCATCTACTCTCGAGACAGCCGTTTTACCTGAAGGAGGCACAGAACACGGAGAGGAGAGTTTATGGGATGAAACCGCTACAAGAGATAATGAC
GGGTGAATTGACGGACATTGATAACCAGTTGAAATCCACCAACAAGTTGTTGAACAGCACCAACCACTTGGAAACCAACACCATTGAGCCTTCGGAGAGC
GGAACTCGTCTGGAAGAAGGGAAGGAGAAGAAAGGAACACAACAGGTGCATTTAATACGATAGGCTTGCTAAGCTGTCAGTACAAGCTCGGAGGAGAATG
AAGCATCAGAAGTCGGCGATCAAATCACCGACTTGAAACACGTGATCCCTTGACGTTGTATCACCATCTACGGACTTCACACGCTCCGGCGGCGGGTGCT
GCCTAGCGATAGCGACCCTCTAGCATCGACCTCGCGTCCCACCCATGTATCAAGTCGAAAGGGATGTCGCCTCTAGCCGATCGTAGGTCGTGTTGATGGC
AAACGCCAAGCGTTCCGCATACTTGTCCCAGTATTTCTGCTTTATGTCAACGACATTCATCTCCAGGTCCCTCGCCAACGTTTGCACCATTCGCTGCACT
GTACCGCTGGTCTGCATGCAGTACGCCACGGCGGTGCGTTACCTTGTCTCACGGCGCGGTTGAAGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNN