Description :
From Genome Similarity Track
Location :
Scaffold_1011:1732- 3701
Sequence
1969 bases(100 bases per row)
ACCAATGGCGCGAAGGTGTCCTTCATCGACACCGTGTACCGTGACGGTACACACCCGTGGTGTAGGTGTCTCCCATCGACACCATGTACCGTACGGTACT
AACCTTTGGTGCGGTACGCCCACCACAATGTTGCCATGTTTGGCGGCAACAGCTTCCGCTGTGCTGTCGCCTGAACAGATTCATGGCCAGTGCTCGCATC
ATGCACGACGCATGTGCAAGCACAGTGTACAGGTCCATGAGCCCGTACACAAGGTACGCTGTGTACGACACGTACCACAGCTACCAAAAGTGCTCCGTGC
ACGTCATGTGTGTCATGCACGACGAGTTCCCTACGTGGAACTCCTGGCAGGCTGCTCGACAGCAGCCAGTGCCGATGCACGGTACGCGCGTTGACTCACA
GCGTCCAGAGCGAATCGGGTCGTGGTATGGTGCATATCCTTTGCACCTATACCAGTGTCCGTCACAGACACCATGTACCTTGATGGTACTCGACCGTGGT
GGGGCACATCTCACCACTATGCCACTGCGGCATTGGTGTCTGGCATTGACACCGAGTACTCACGGGTACCAGCCCATGGTGAGGCAAGCAGCCATCACCA
CGATGTCATGCTCGGCGCGGCACCAATTACGACTGCGTGCGTTGCCTCGACCACCACCTGGTCAGTTGTGTGTGCACTCGTGCACCACACTTGGGCTATG
GCTCCACGGCCCATTATACCCGGCGCGTTGCGTACATCACGTACCGCAACCGCTTTGTCGGCGGGTGAGACGTTCCGTTCACCCTACTCGACAGGTCGTT
CATGGCCAAGGGAACGGTGCGTTGATTGCACTAGGCCCGCGCTTCGCCTCGTGTGTGGTTGCTTGCAACCCCAACACTGCTGATTCGGTCAGCGATTCCG
AGGCACCTTGCGCCAGTGGCTTTCTTCGCCACTATGTCTTGTTCGGCTAGAGCTACCGCAGCTCTAGCCCGGCTGTTCGCCTCCAGCCTGCAGTCGATGT
ACATCGACGCCTGGTTCCGTAAGGAACTTGGTCTTACCTCAAGACCAGGGAGGAAAGGTATTTCCGAGCCTCTCCCCCACTTACACTCGAGACTATTGAG
TCTCTCGTGGCTTGTGATAGTCACTGGCAGCACGACGGCTACTTGCCTCTTGGAAAGTCAGGGAGGAAAGGTGTTTCCGAGCCTCTCCCCCACTTAACCT
CGAGACTACTGAGTCTCGCGTGGTTTCTAATAGCCACTGGCAGGCGCAACGGCTCTCCGCCATGTGCACTGCGTCGGTATGGTCGACCGCGTCGGCCGTG
TCGACCGAAGGCATTCAGCCTTCGCGTCGGCAGTTTGAGTCTGCTCGACTTGACGTCGAGCGAGTTGCTCACGTCTGGCGAGGCCGAGACAACCTCGCGC
CTCGAGCCAATGGCTCTGTGTGCGGCGCTATGGTACTCGCCTTGGGTGTGGACCTCTGTTACCCACACCGGAAGCGCATACAGCGACTTCCTTATCAGTT
ATAGTCTGAGTGACCTTGCGTGGAACTTTGTTACCCACGCTCGGAGCACCGAATGTCGGTCTCCTTAAGCAGCTTCGCTGCTTGCGGAACTTGTTACCCG
CAGTGTGGACCTATGTTACCCACCTGGTGAATGCTCTTCGGCACCACCACTGTCGAAGCGCATACGGCGCGACGACCTTCGGTGTTGGGATCGGCTGGTG
TGGCAGACCCGCACACACACCGGACAGTGTTGGTGTCCACCGACCGAGTCAGAGGAGTCTGGGCCCTGGACTCCGCGTCGCTTGAAGCGACGGCGGCCTG
AACAAGGTTCAGACCCGACTTGCGGCGGCTGACGTGACGTGGCACTTTGTTACCCACGTCGTGATGTCTCGTTGACGACATCAAAGGCACTCGAGACCTC
GTGTGGCACTGTGTTACCCACACAGGAAGCATGGACAATGCCTTCCTCTTCAGTTATAGTCTGGGCGAC