Description :
From Genome Similarity Track
Location :
Scaffold_2521:1732- 3473
Transcript NameFunction/comments
Phyta_totarag14577hypothetical protein

Sequence
1741 bases(100 bases per row)
ccgTCAAAATCTTAGTAAGACTGAATCCGGCTTCCCAACTTTacccagacaccgactaacggaggggttccccgatgatccgtgatctgTTGAACTGGCC
ACCTTGTGTATCtgtcggtgggctggatctgctctctTGGTAACTCCGAGGAGTCCAATacgtgaagaacttgaaCGTCGTGGCGAGACNGGTTAGCCTT
CATATCTGCCTTTTCCCCATCCTGGGTATCATCTACAACTAGGCAACACCTGGATTCTTGCCCCGGCTGTACCCGATTGTGCTTCCCATCGATCCCGGTC
GATCGTCAATCTGCCAGAACCTGTATGCCGATCGTCAATCTGCCAATATCTGTATGTCGATCGACAATCCGCCTCGATCGATGTTCTGCCTCGGTCGGCA
GCATGCCTCAATCGGTAAGTCCGCATTGGCCGGCCCGCTGTTCGTCGATCCATCGTCGATCGGGCTCTAGCCGGTCCCGATCTATTTCGATCTCTTCCTG
TTATCCATCCATCGCTATCTCCATACCTTACAGCCCATACAACCACGATCTTGGTCAACCGTGGGGCTCTCGTGAGCGTGGATCACCTCCGATCGGCCCT
CTCCTTTCCTCTCCAGCTACGTGCGTCAATCGATCAGGCACATCTCGGACCTCATCCGCCCCGTTCCATAGTTCGTGCGGTTTCGATCGCCTCGCTTTTC
TCTGGCTTCTCGATTTGGCTCCCGCGTCGTCCTTCTAGATAGGCATCGTTGCATTTCTCGCTGCCTGCTGCCTTTCTCAGGTTGGCCTGCGATTCTtatt
cagcacttctccacactGTTTATCGAATGGAGAAGCAGCCAACGACACGGCTTTGAACTCTGACAGTGAAGAAAGATCCAGCGACCAAGCGtatgctgaa
gatgaagaagaattGGAGCTCACTTTCTCgtcggacgaggaagaaggtgACACCACTGAGGCACTTTCGAACAGTCGGTTTCTCCAGACAGCGACCAACA
ACAGCCTCATGAAGGCGATGCGGCGCAAGAGTTGGGAGTATGATATGTTTTGTATTGCAATGTGGCTATATGACCGATGGCTTACTGGTTTACTAACTGT
CAGTGATATTACTTTGTAGACATGTCACGGTTCGGTCCCGATCCAACGTACACTGGGCTGTACGACGGTCCGTATGGACCGGGCGCTTCGGTTCTCGGAA
TTATGGAGGATCCATTGGcgcgtttttttttcttcttcttcctaCCCGCAACATTATGGCACAAGATCGCGAAGGAAACGAACGCGTATCACGTGCAGCA
TATTCATGAGCGTGTGCGCGAGAATCAAATTATGCAGCGCAAGAGTAATCCTGACAACGTCGCGTAGATGAAGGACATTCGGAAGCATCTAGGGGCAGTC
CGTTCAGTGGAATCTTGGGAGCTTCTGCGCGTTATAGGGCTACTAATTGCGAGGATGCTGGCTCCTCCGGTGCGAGGCCTGGGCTCACTGGAGTCGCAGC
CAACACGGCGTCGTCCCCCCGGGAACGTTTGGCCACTGGTTGCCCAGAAATCATTTCAACACGTGCTGCAGAATCTGCATTTCACGGACAATAACGCTCC
TCGGGCTTGCATCGACCGTGGCTGGATAGTTCGCATCATCGTAGCctcgctgcagaagacgattgcACGGGGGTACACGGTCGGCCCTGTCATTTCGTTT
GACGAAACCATCATCCCGACACGTGCACGTCGAAATCCCAC