Description :
From Genome Similarity Track
Location :
scaffold_224:1732- 3120
Transcript NameFunction/comments
Plaha_PHALS_03305RxLR-like protein

Sequence
1388 bases(100 bases per row)
TACTTGACGTGGATGCCACGTAGCAAGTCACGAACTTCATTCCGGGGTGCCAAGATGGTGTCTCATGTGCAGCTGCTGAGTTTGATGGCATTGCTCGCCT
TGCTACAGTCTTCTTCCACTAGCGCTAAGCGTCTAGATCTTGTATCTTTTGAGAAACCTTTTGACGACGTTGACGCAGGAGGCTTGCGACAGCTTGGAGA
AAACTTTGTGTATGGTGGCGATGCGGCTGTAAACCGCCACTTTGCTCGCCTTACACCTGACCGACAGAGCAAGCGTGGTTTTATATGGGGAAAACAAAAG
TTGGCGGTCAAAGAATTTACTGCAGTGCTTACGTTTCGTATCAGTGGCCAGGCTAAATCCTGGTTTGGCGATGGTTTGGCTCTCTGGCTTACGACCAGTG
AGTACATGCCGGGTGATAATCACGGCTTTATTGGGGAATACAAGGGAATTGGCATTCTATTTGATACTTTCGTCAATAAGGAGCATAGTGGTGGTCACAA
AGATGTTACGTTCTTTGAAAATGACGGCACCAAGACACTTGACCAATTAAACGACATGGAGAAGCAGGGCTGCATGGCACCCGGTATTCGTTACCACGAG
AAAAACGCGGCGTTTAACCCGTCACTTAACATGTCTCGTGCTAAGATTACTTACACGCAGGCTGATCAGCACATTACGATTCTGGTGGACGCCGATGCGT
CGGGTAATTGGATCAAGTGCTACAGTCAGCGCCTAAATTTTGGAGACGACTGGATGAGTGATGCATACGTTGGCATCTCAGCCTCGACAGGAAGTCTAGC
CGACAATCACGACGTCATTTCTATCAAGGTGTATGAGTAAGTTTGTTCTGATTCACCCAGAACTCATGAGATGCTAATGTCTAATTCAAAATATAGTGAC
GTGATTGACTCGCTAGTAGACCAAGAGGATGAGAAGCATCGCAATGCCAAAGACAAGACGCTCGAAGCCAAACTTAGCGAAGGAAGTATTGATGACAGGA
TGAAGGTGGTGAAACAAAAGTATACTCATTTAATTGAGGAATTCGAGTATAAGATCACTTCACTGAAAGAGTCAACGGACACTACGATTCAAAGGCTCAA
GCAACAGGAAATTGAAGATGAAAAGCGTATCGAGGAGCTTGAGGCTTGGGCGAACGGAAAAGTGCGTGAGCGTGTGCACAGCACCGAAAACGCTATTCGA
GACCAAGTAAATCTACAACTGGAAGCTACTGTGAAGGAAACCGCTGCCAAGTCTAGTGGATGGAAGACTCCATTTTTCATTGTTGTGATTATTATCGCTG
GGATTGTCGCTGTCGGTTACCAAAAGTATCAGGCGCTTCGCAAGACACACTTCCTGTAAACATGGTGCACTTAGATGTTCCTTGCTAA