Description :
From Genome Similarity Track
Location :
Scaffold_4:1731775- 1732783
Transcript NameFunction/comments
Phyin_T30-4PITG_03429Putative uncharacterized protein

Sequence
1008 bases(100 bases per row)
GTTTGCTGATGCTTCGGCGCTAAGTCGAGATGTTAGTCGGCGGCGGTAGTGGCTCAAGCAACGGAATCGTTGCGATGAGCTCCGCATCTGGCTGGACTGC
TTCCGCTTTATTATCAGTTGCAGCCTTCGAGTGACGCACGCAGAATCCAAGGCGTTGAGCCCACTTTTGGCAGCTTGGTTCCGCGCAACGAGACCCTCCA
CCGTGTGACCGACAAAAACCCTTCGAGATGGCACCCTTCGCGCAATCGGGGTGTTGGCACCGCACACCTCCGCCGTGAGTCTTGCAGAAGCCGCGAGACT
GCACAGCACGCCGACATCCCTCGATACTACACAGCTTAATCCCACCGTGTGAGCTGCATTTGTGGCCGAATTGCGCGACGCGCTCGCAGCCAGCTTCACC
ACACAGCCGTCTCCCACCGTGGGCAGAGCAAACGCTATTGTAGCGTGCAAACTAACGTTTGATAAGGATTAGATGCTGCCCAAGAGATACATGATTGTAC
AAGCCAAAAATATTAAAACGATTACCTTGGCGCAGCCTTCAACTTCGCAGCGACGACGACGGTATCGCTTGGGAGTAGGCGAAGATGTTGCTTTGTCGGG
CCGTGGGCTGTTTATTTTGGCCTCTGTAGGTGCGTCGTTTGCATTTGGTGTTGGCATAGCCATCGTCTTTGCCTCCACATCCTTATCCGCTTCTTCGGGC
GCTGCATAAATAGTAGCTTCTGATTTGTCTCCACTAGCAGCAGCGTAGCTAGCTGATCCAGTAGTAGCAGCGTTCACAGAGGCAGTGGTGGGCATAGTAG
TTCCAGGAGACCCTTCATCTTCTCCCGTAACCGGTTTCTTTTGCTTGTCCTTGGCGATCACGGCCGCCTGAAGCAGCGTGTCGATCCACTCGCGAACAGG
ATGGCCATCACTGTCCGTAGGAGGTTGTACAGCCGGCGCACCTTGCTTGTTAGGCTGATTCTCGATCAACTCGCTCATCGCCTCCACTCGTTACACTTGG
ATCAAGTC