Description :
From Genome Similarity Track
Location :
Scaffold_41:173163- 180664
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14735hypothetical protein
Phypa_INRA-310PPTG_14736hypothetical protein
Phypa_INRA-310PPTG_14737hypothetical protein
Phypa_INRA-310PPTG_14738hypothetical protein

Sequence
7501 bases(100 bases per row)
GCTTTGACACACCATCGGAAGTGAGACCACCAACACCATCATATCCTCGTGCCACAGAATTCTCGTTATCTTGCATGAAGACCACCTTGTTCGTGTACTC
GGGGCCACTGAAGACGCTGCGTGCTACCGCCATGTCGCTTCCCGTTCCAAGCATCAGCGTGTCAACACCAGCAGGTCCAAGTCCCGTGTGTACATCAACC
ATTGCAAACTTGGTTACGGTGTTGAAGTCGACATGTTCCCGTAGAAAATCCTGTAGCAGTGCCAAACTAGGCTCGAGCTCCGTTCCACCGAAGAAAAGCG
TCTGCGGGAACCGATAATTCCCGACAACTGTCGCCTGTTTTATCGCGTTAAAACCTTTTGTAGCTAAATTCATAATGCCTTTCACCCAGAACGAGTTCTT
GACACCGCCCAATTCTTTCGGGTTCAGCAGCTCGTAGACATCCATATATCCCAGTTGGTTTGGGTCTCTCGCTTGGCGTTCCTTGAATTCCTCTGGCGTG
AGCCAATTGCGGTTCAAGTCCACACCATGCTCATTAAATCGACGCAGCCGTGCGAATCCATACGCATTGAGCGCGTGCACGAAGATCACCGTGGGCTTGT
TCTTGGCGGTGCTTGGGTTTTTCGCCGCTCGCTCCAACAGAGACGCCTGGATTGCGCTTCCAGCAAAACCTTCGACGCCATGCGTGCCTGAAATATGGAG
TAGAACACGACCGCTAAAACCTTCGAGCACTGCAATGTCCACCGTCAAGTCCAACGACTTTAGATGATCAAGAGGCAGCGAAAACAGCTTGGCACCGGCA
CTCTCAGCGCGTGATCGGAAAAGTGCTCGAGCCTGGTAGTATGAGTCGCTGAAATGGGCCTCCACACTGACGTTGGTTGTGGGAGTGGGTGAGTACGAGT
CCAGAGGCACAAAATCGTTGTATGCGTGTACAAGCAGCGCCACCAGGAGGGCCCCGATCGCCGGCAAGGATACCCTCATTTGGCTCATTTGTCATCCAAA
GTTGAAGAATGTGAATCTATAAATTCAGGATAAACTGACACAAGTTAGCAATATCTAGATTGTCAATGCTAAACTGAATTTTTTTTCTTAAATGAGGAAA
TACAAATTTAGATATTTCTAGATTGGACATGGGCTTTTGCAAATTGCAAGTTGCAAAACCGACTGCCACCGACGACGAGCTCGTTATCAGGTGTGAGGAC
GCTGTCTGCTACTGCCGCTGTGCTCTCGCTCAATTGCCTCCGTGCGGTCGATCAACGCGATGGGTCAGCACTGCTCATGCTTGGAACACCCGCCCAAATA
CCAGCGGAGGCAATCCGACGACCTCGACTCGGTGGACATGGAGCGAGGCGACGACGGCGACGACCAGGAGCTGGAAGTGTTAGTGGACGCACAGGAATCC
CACGAGCTGCTTGGTGCCAGACCAAGAACGAGTTCAGGCGGTAGAAGTAATCAACGGAGCGTCTTAAAGCGAACTGGATCGACTGTCGCTGCTGGACTCA
TGGCAGACGCAAATAGGAGAGAAGACGAGCGTAAAGAGGAGTCGGAAGAGCAGTGCATGCGTCGCAGTCTTAGCATGGGTCTCATGGGGCTGGACGCAGA
CCACCGCCCGACACCATCTCCTCGACCAGAAGAGCTGTCAAGGCTGCTGCGCTCTTATCAAGAGGTCACTGGCGTGGTAAGCCTTTGCCTTCATTTCATT
TTTAACTGTGCACGGGCTGATCAGGAGGTATATTTTGCAACAGGTCGATGAAGGCCAACTTGACCTCGAGTGCATCATGTGCTTGGATACATTTTCTGAG
GTAGGGATGTCTTAGAAATTGCATCTTGAGCTGATCTAACTGTGCTGCATGTTTTGATTTCTATAGAATAATCCGAAGGTTCGCACGCTGTGCAATTGTG
GCATGAACCGCACCAACTTTCACATGAGCTGTTTGCTCGAGTGGCTTAATCGTGACGCGAATTGCCCAGTTTGTCGCGAATACCTCTTCTTCGAGGACTC
ATAATTATACTTAACTATTGTCCTTGAACGAATGCTCGTACAATGAGCGACCTCACTGGGTGTTCAAGCAAAAGAAGACGAGTACGATCAAACGGTAGCC
CCATCCTCCCCCAGGGCGCTCGAGCTCTGTTGATACCAAGCTTATTCCGTAGTTGCAACCTGTCAATTATCGTCGCTTTCTGCAGCGACAGTTTTGCTTT
CGGCCGAGCGCATGAGACCTGCCATACAGTAGGCACCGGAAACGTCCTGAATAATAACATCATGTATTCTATTTCTTGGGAAGCGTTTCACTGAAGTCTT
TACCTTGCCAACTACTTGCTGCAATTCACGTGTGCTGTCCAATTCGATCACGAAAAGCATAAGTGGATGCCACTGCTACGACACCAACCGCCATTGTTGT
GATAATGATAGAAGTCTAGAAAGCAACACGAAAATACATCAGTACACGCCGGTACAGACGAATCGAGTACTAGTTCTTTTCGAAATACCTGCCAGGAACC
CAGAATGTAGTTGGTCGTGTCTCCATCTCTACTCCACGATACAATACCATCGAGCCCCAAGCAACCGTCAGTAAATGATTAGGAACAATAAAAAAAAAAA
TGAAACCTGCTTTACTAACCGTGACAGCCGAGCGGGTAATGGCGGAACATCTTTCAGCATCGGTTTACTTATGCAGGGCCACGGTTGGTATTCGTAAGGA
TACTGGAAGTACGCACATCGGCTACTGTGTATATCAACAACGTCAAAGCTTCGAAATTGCTGCCCTGCATCAAAAACTTCAATGCTTATCGAGTAACGTA
CACTGAGCCAGCATCCAGGTCGCTTAGCTTTCTTAGCTGCTCCGGAGGCAATTGGTGGAACAGCACAAGAGCACGTGCGATCACCTTTTCGATATCCATT
GAGAGTGGTAAGCTTGACAGCATTCCATGTATCGTTCCGAAGTCGCGTTCGCACCGCAAAATCTTCTCTCTCGCCTCAAGCACAACCTACGTACGAAAAA
GCACCCGGGAACGAGTTAAAGGCCCGAAAAGAAAATGTTCAGGCAAGACCACGTACTCCTGCAGATACGTAGAGACTGAACAGCGGGTGAGTCACAAGAA
ATACGTCATACAGCCGCGCGACATCCCCGAAGCGTTTTAATTGGTGCGCAAACCACGTGATCATCCAGGGCAAAGCGAAGAACGGTTCCACCTGGAGTAG
TTGACACATACCAATCGTTGCCAGTACTTGTCAGTGCTGCTAAAACGAGGTGCATGTTTCAATCAACGGACGTACCCCCGATGCATGTAAATGTTGGAAA
AGCAGCTCGTCAGCAGCATCCAGCAACGGGAACAGCAACCTAGTGGTTTCCATCACTTGCTCAAACCCTGAACGCATCGGTTCGCGCTGGTATGTCTCGC
TCACATTCTGCACAGCTTGCATCGTGTTTTTCGAGTTTCCCAGTGTCAGCAAAAACACCGAGACAATGTCGTGATAGCCTTGGAAGTAAAACAGCTCGTC
GTTGGCGTTCAGCACGCCCAATATGATCTGCGTTAATGCGCGGCGTTTAGAGCGACGATCGCTCTCTTTGATCCTCTGCAACACGTCATAATGCCACAAA
GATCGCTCCACATCCTTCTCCACCTGCGCTGCGTCTCGGTGTGCTTCCGCCGAGCTGTTTCCAGTGGTAGACAGCCCATTTTGAGTCAATCGATCAACAC
CAAGCAGGAACGGCCATGCCTCCCTCCGAAACTCTTCTGAAACGAGACCTTTCGGTGTTATTGCCAGTCGGCGCACTTCGTGGAAACATTGGTCTCGTTC
CTCAACTCTTGCAACGTCGCCGTGGCGTTCTAGTGCACGCAGGTGAAGGATGGCCGCGCGGAGCTCCCTTTCCTTGTATTGGATGAGACGGCGCTCGCGC
GCTGCGGGTGCCCGTCCTGGGATGCCCCGCACATGGCGTCGACTGTGCTTCTTGCTGCCCATTTTGCCAGCGTTGGAAACGAATCGACGCAAACGTCGCC
AGTTGACTGCTTTTTAGGTGTAATTTTAGCTGAAGCAGTGGTTAATCGCGGTATTTAAACGCTATTTTCAGAATGAAAAAGGGACACAAGATGTCCAATC
GTGATCAGCCTGATCTTTTGGTGTCCACACATAAACCAGCTGGGGTGATTAATTTGATTGCAGCTGAATTGGCTTCACCGTGCCGAAAGGAGCAATACCA
ATACCCAAGCCATGTCTACCGCTCCAAACCATGGATCATGGGCCAATTGTCCATGGTGGCGTGGGGCAGCGTCCGATTGGCATGGTGCCGCCGCTTTTTG
CTGAGACTTTTGCTTCGGTGTCGCGTCGAGATCCATGAAAATTATTTGAACAAAGTATTGCACCTTTTCAAGTCAAAAATCAGCTGTCGGAAAGTACTGA
TTCAAATGCTCATCGAGTGGTTTGCTTAACCTAGCTTCACCGTCTGCATGCGATCTCGAAGGTTATAGCTTTCTGTATCTTTTTGAAACCGAACGTAACA
GGTGAACCGTTTCATTATTATTCAATTTAGAGGGTAAACTCTCGCTGGGGATTCTGATTTCTCCATGGACCACCTTTCACTTGGCTTCACTATGCTGCCG
TCTACTCCAACCTTGGGACGTCATGATGAGGGGCAGCTCCCGTCGTCCGTTGGTGTCGGCTCAGTGTGGGATATCGCGAGCGACGGCGAAAGGTCCGGAA
AGAAACGCCGAGCGGACGACAACCGCGTACTGAGCTCCAGTGTTCGGACGCCCTGCATTTCCAGTCGCGATCGGCGATAAGAGCCCCACCAGCTGGGCAG
TCGCACGTGAACTCAGACAGGACCCCGAGGCTCGGCTTGACGGCCGCTGTCTCTCTCTTCTCTTCAGTCAGTCTTGAACGCCCCGCAGTCCGCGCAACAT
GGCGCGTTCCGGCAGCGATGGCGAGAGCGATGACGCTATGCAGTATAGCAAGCCGCTGCGTCAGCAGAAGAAGCTCTGCGATGAGGCCATGGAGCTGGTC
AACGCTGGCGTGGCCATGCAAAACGCGTCTCCGCCCGATGCGGCGGGTGCCGACGCCAAGCTCTCGCGCGCAGTGACGCTCATGGAGCAGGCACTGGCCA
TCGAATACCCGACGCAGGAGGAGCGAGACGCCAGTCAACGTCTCAATAACAAGATGAACCGATACGTCAAGATGATCCGCAGCCAGCGCGAGAAGGGCAC
GGCTGGCGGCGCTACGGGCCGTGGACACAATACCAAGTACAACATTCTACCCATGGACAACTTGCCATCCACGTACAATGCCGTGGTCGAGCTATTATCC
AAGTAAGAAGACGCTGCGTGAATTTTCACATTATGAAGTGGGTGCAAAACTAACACTGATTTCTCTCTCTCTCTCTCTCTTTGGACAGCTCGTCTGCTGT
AGGTGATATCTTTGAGAGCCTCAAGGGTGCGTTCGGTTTCCAGGAGTCCAATGTCGCCAACCAGAAGGAGCACGTGCTGCTCATGCTGACGAACTTCAAG
CTTCAGGAGGAGGAGCCGAACCAAAACAACGAGGAGCACCATCAACTGGACCGACAGCAGGAGCTGGATATGGCCAATAAGGGCATCAAGCGTTTCCACG
GACGCATCTTTGCCAACTACACCAAATGGTGCAAGTACGTGTCGACCAAGCCTGCATTCACGAGCGATCCGCTCGTGGATATCGTGCTGTTCTTCCTGAT
TTGGGGCGAGGCAGGTAACTTCCGTCAGATGCCTGAATGCCTCTGTTTCCTGCTGCACACGTCGCTGCCCCAGGCTTCGTCTCGTGGTGGTAGCAAGAAC
CCCGGCGACTTCCTTACGGAGGTTATCCGTCCGATGTACGAAGAAGTCAAGAAAGACAACGACAAGAAAACCGCACAGGGTGCTCGTGCTCCTCACGCGG
AGATTCGTAACTACGATGACTTTAACGAGTTCTTTTGGAGCAAGAAGTGCTTGAAGTACAACCCGACGACCATTCACGAAGCTTTCGGTGAAGTGGACAA
GAAGGGTCGCCCCAAGGTCATTAAGAAGAGCTTTGTGGAGAAACGCACGTGGATACGCGCTCTGATGTCCTTCCGTCGTATCTTCTGCTTTAACTGCGCG
CTGTTCCTGGCGGTCTGTGGTTTTGCTCTCAACATGGTCATGTATTGCCCGGACACGCCTATCTTGTATGGCGCTGATCTGAGCAACGGAGACTCGCGTG
GTTTTACTGTGTTTGGCAAGAATTTCACGGCATCTGACAGCACTGGCATTGGATCTGGCGACGGATCAGAAGACAAGTCGAGCGATGGATCTGGTCCTTC
CTGTAACCATCAAATGCTGGCTACATGTCTCGGTATGACCTATACGACTGGTATCTTTGAAGACATTCCCATTGATTTCAAGGCCCTGCTCCAGGTTGTG
CCGTTCACCGACTGTGTGGAAAAGAGCACGGGACGGTGCGGATGCTACTTGGATCTGATTGACAACTGCTTCGCGGAAACAGGCCAAACTACGAAGGTCA
CAGAAGACGAACACACGTTCTCGGCTTCAAGTGAATATGACCAGAGCATGTGTGTGGTGAACTGGCGTGCTGCCGTTGAGAACATCATCAAGAAGCCTGG
CCCGGGTAAGCTGAACTGCGAGATCTGTCAGTTGGACATCAAGGCATTGATCACAAACGGCAAGATCGGTGATTTGTTCAGCGGTCTGCTGCAAATGGGA
GATGGTACCCCACTTGCGGACGGTGACATCGACAGCACCAAGCGAACAGATATGGGTGGTCTTGCTATGCTTGGCGGTGCCGGCTGTCTGGGCCTGGTTG
TTGCGTGCGAGTTCTTCAACAAGATCTTCTCGCGTGTTGGTTCGGGCTACGTGGGTCGTTCGATGCCGGTCCCCATTCGCGCATANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N