Description :
From Genome Similarity Track
Location :
Scaffold_447:173086- 174315
Transcript NameFunction/comments
Aphin_H310_09141retrotransposon protein putative

Sequence
1229 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTTGGAAGCCA
AGGGTGGCAAGACAGAGTATTAGCACCCTAATGTAGTGCGTTAGCCATGTTTTTGCATTGTGTAGCGCAGTGGGTCTATTGTACTGGCGCAAGGCCATAC
CACACACCTGAGCAATCTAAATATGTATTGCATTTGCTTCGCCCATATTGTATTCTGACATGCTCGTACTGTCATATCGATCCTTTATAATCAACAGAGT
AACGATAGAAATGACCAGGGTCAAGGACGACCCATGAAGAGAGGGTGGGTCTATTCATGTAGCGCGTACAGTATGCAGATATTCAGGTCGGACCATCATT
CCGACTCCTTATGCAAATACAGAGGGCAGCGGTCGATGTCACCGCATCAAAACCCTCCAAGCCCAACGCTACCCTGGGCTGGCAACCAAGCCGTGTACAT
CGGCCATCCGCTGCACGTTTTTCGACCCTGCAGCACACTCAGCAACGTAGTGCGCACAGCATAAGGCACGTCTCCAACGAAGACGTCACAGGCTCCCAAG
TCTTTTCGAGCTCGTCGAGACCTCGCCATTTTACTAGAAGCATCCACTGCTTCAAATTCCGATCGAACTTGCAGTCGACCAGTGCCTCGATCTCATGACC
ACCATCCACGTACGTAATGTGGTCAAGCAGGTCTTGCGTGATTGTGGCGTCCTTGGCTGCGTAATGCTTCATCCGACGAGCATGATGCTGCGAGATCTTG
CCATCCCGCACGTCGTCAACAACAAAACCCAATCTGAATGCATGGGTATGATCCTCTTTGGACCGAGCCACGAAATCGCCAACTTGGACCCGTGTCCCCA
GGAGATTTTGCCAACCAGCACGTAATCTCCAATGTCAAAATGCATACGACGCACCACCGATTTCTTGTTCCGACGCTGCCGCTCATGCCACGTTTGTTGC
GACTAGTTGTCGCCATCTGATGATGTGATTGATCGCGAGTCGCCGCGAGCTCTTTCCAAATTGTAGAACGCCACAACTTGTGCGTCCCCTCGCTCACTTC
CTGCACAGTTCCATTACGCTTGAACGCATTCAAAGCGTTGCTCGAAGGTAGTTGTGTCATCGCAGTAACTGGTGCCAGCCCACCATTCCTTTCACAAGGA
GTATGGTTCAGTGCATGCTGTACAAGTGG