Description :
From Genome Similarity Track
Location :
Scaffold_324:17307- 22605
Transcript NameFunction/comments
Hyaar_Emoy2813760choline/Carnitine O-acyltransferase, putative
Hyaar_Emoy2813761aerotaxis receptor Aer-2

Sequence
5298 bases(100 bases per row)
GCAGCTAATAAAAGCCTTCTTTTCTCCTCACTAGTGACGGCACCTGATGTGTCCGCTATCGCATCTGTAAACTTGGCACTTGCTTTCGAGGAGCTACGTG
TTGTTTCTGTCCGTCCGTGCAAGAAAATGCGCGTCTGCACAGCCTCGTACGTAGCCACGTTCTTCTTGAATAGCTTCTTGTAAGCGAGCTGGATAGCTAG
TTGGACAAAAGCATCCGGACTACAACGAAATCCCTTAATCAGGCGCGCACCGTAGCCGTAAAAAGCCATCACACAGACTTCGTGGTCGATCACCGTCTGG
TCAAATTTCGCTTCTGCTTCAGCAATATTACGTCGCGTCTCATCCGTCAAGCGAAACATAATCTGCTTCGGAGGTTCCAGCGCTTCTGTCAGCTGCGCAA
TCGTTTGACCATGGCGGCCCAAGTCAATCTGTCCATGATGCAGACGCGATAGCACGTAGTCCGTATAGCGTGCCATGGGCATACCATCGAGCATCGAGTG
TTCTCCTACGAGCCCGGCCTTGCCGTTCTCAAACACGATAATCTGCACGCACTTGTCAAAGAAGCGGTTGCGTCCGTTGCCGTGCCAAAGGCCACGCGCG
ACTTCTGTACGCGTCACTGGTGCGTCATCGTCCATATTGAGTATCAATAAGGAGCTCTCAATCGTCCGCAACGATTCCTCATTCCCCGGTGACGCTCGAA
TCAACTCCTCGCGGGCATCCGCCCACGTATTTCGATCCTGCGTCGTCAACACGCCCACTGGCATCTCTTCACCTCCTGCAGCATCCAGGATCCGAGCCAA
TTGAAAGCAAAGCGCCTCAAAACCCAATACTTCTTTCGACCGTGGATCCACGAGCTCCAATCGGAAAAACTGGTTGCGACGCATCACCACGGCATGGGTG
TGCGTCTTGGGATCATAGATCCGGTACGAGTCCTGCTCACGTCGTGGAATGCGACAAGAATGGAACATGTACTTGTACGCAGTGGCACAGACCGGCGTCT
TGTTCCTGCCCAGTCGCTCTGGCTCGAGCGACCCGTCGGTCACGTGGCCAGCAAAGAGCATGGAGGCCCTTAGTAAAGCTGCCGCTCGACCGACATTCGA
GCGTTGACTTGGAGAAATGCTGTCTGCAAAGTGGAAAAAGTAGCTCACGTTAAATACGACGGGATCCCGGACTCGGAGGTATCCGATCGTGTTCCACCAC
TCGGCCAAATAGCTCGAAGCGTGGCGGTCGTGCGCACGAGCCACGAGGCGCCGCTGCAGTTCTTCACCTATGCCATTAGGTTGTAGAAAGGCACCGGCCA
GTTCTTTCGAGTGGGCGAGTTCTGCGGCTGATACAAGAGGTGGTAGAGTGGATAGGTACAGAGCGATAGTGTCTGCGAGTGGCGGCACGGGCAGACGCGG
GAGGTCGCGCTGGAAGCAGTAGAGTGGGAGCGAAGGGTCTTCTAGGTCTGCTTCGGCGCGGTAGTCGCCCCAGCATTCACGGAAGCCTCGTGGGCCAAAG
AGACGGGATGGCATTGAAAGTGGTTGTGAGGCAGGAATGATGGTCAATCTGTCGACTTGAGCCTGAAGCTGCAAATTGTCGATTGCGCTTCAACTTGAGT
GACGAGATCGATGTTGGATCAGCTATGGCGGTGATTGGCTGAAACTCGAATTGATGGACAATTTGGGTGAATGGATGACAACGACGGGTCATTTGGAAGA
GCTGGCAGTACTTCTGTAATTGTTGTTTGCTACAGTGTCCGGATGTGGACTGACGACTGAGTAACGGAGTGATGGGGGACACGACATGTTGCTGAGTTCT
AGACGTGAAACGAAAACACTTGCTAAAAAGTAGGTTTTGGCTCGTTTGGACAGCAGCTTGTGCATTAGTAAATGACTGACGCTGACGACTCTCGCCTTGC
GTTTAGCGACGGCTTTCGAAGCCTTTGTAAAATGCGGTATACTTGAGCAATGCGGCATGCTGGATGTAGTAGAGGCTACGCATTACTGCAATATGGGCAG
GTGAAGAGCTCGTGATGATGGGGTGGGCATACAAGGCGCAGACCGTTTCGATACAGTATTGATACCGGGTGGATAGGCGGTAAGTGTCTCAACCTTTTGC
AACCATCAAGTTGATTGAGAAATAAGCGAGCACGTTCTGCCAACATTTACCAAATTACGACCTGGCTATTGCAGAGGAGTTAAGTAGAGTATAATTGCGA
TGCAAGAGACCGTAGGATACCGATGTCGTGAAATGACCGAGGCTCTAAATTGGACTTATTGTACCGCGATGGTGCGATTTGTTAAATCTCCTGGTGAGCA
GTATCAAACATTGTACATCTCCGCGGCACCTATGTGTATCAACTGATGCGTGCGTGGTGATGGTACCGCAGTGTACTAAGGTCACCACAGAGTATTCGAT
GCCGTGACGACAGCTGGTGCTTTTTTCGTGCTATTATGGCTCTATTGCATACGTAGTACTGGACTTGGAGGCACATGTCGATTGGGTTCTTGAATACTCT
CTTTGTAGCATAGAGGTGATGTGCATCTGGTGCATGGTGAACAACTACTTTGACGCGAGGTTGTCGAGCTGAGCACATGTCCTTACGTGGTACGATTGGC
GAAGGTTTACACGAACAAACTGCATTCGAAATCTAAAGACAGAGCGACCGATAGTGCCCAATCTTGAGTAAAAGAGTGAGGTGATGGTACTTTATCATCA
TCGTCTACAGATACTTCTGCAGGAGCAGTCCCGGTCGATGGAAGCGCAATACCTGAAAATTCAAAGTATCCATCATACTTTTTGTACAACGAGCGTGTGT
CGTTTGACAATAAAGACGAGGTCTTACTTGCGGGGTCTTTTTTTGCTGAATTGAAGATTGAATGACATGCGGTCATGATTAGTGGGGTATGAGTGCCGAA
GTGTGCAAGAATTAGAAATAGAGATCACAGCAGACTGAAGTGCTTGTGTTTCGTGCTATAACGTGCTGAAGCTGCGTAGCCTACTTGTACATGACCACCT
GGATCAGTTGCATACGGATTCCTCGAGGAGGCTGTGTTTGGTGCCCAGTTCCGACATCCAAACGTCATATTGTTTACTAATAGGTCGCCTACAAAGGCAG
CTTGTGTCTCGTCAAGTATGTATTGAAGATGTTGTGTCCGCATACAATACTTGTAGGGCTGGCTGCGAACGATCTTGTCGCAGAACTTGTGTTATCCGCG
AATATTGCACACGTAGGCCACTCCGAAAAGCTCTTCGTGCACGTTCGTTCTTGGAGTGACAGCAGCAAGTAGTCTGGCTTACATGCAACTGCGAGCTGAT
TTACCTGCATCGAGACATCAAGACTTCTAACACACTCGTGACTACCGTCTGGACGCTTAAGATTGCCATTTCGGAATTGCTCGGATTGCGACTGACTATG
AGTGCACAAAATCCTTTTCCGTAAAAGTTCTCATTGCCGTCTCCTCCAACCGACCGACGTAAGCGTCATGATGACTGATGGTGATACTTTGATGCTAGCA
ACGACCTCTGCGAGCACTTGGCACTGAATTTCTCCAGAAATCATGAGGAATCCCAATGATTACACTGTAATCGCGAAACGGACATGTACAGCTTTGGGGT
GGTTCAAGGGAAGATCTTGATTGACGGAGCAATATTCGGTGACGTCGACTATGACCATCAAGTATGACAGCTCGTGACGGCTGACGAGCGTCCGAACATC
CCCTTCATCTACCTGTGGCGTGCGCCACCCCAATTCATTGAAGTTGTGTATGCATGCCGGCATCAGCGACCACTAGAGCGATCTAAGGTCCAATATGTGA
TGCTGTGCTGAGGCTCGGTGTCGTACACGCTACCGAATGGCTCATGGTTTTTCTTGTCGTCTTTGCACACGAAAACTATCATGGTATTGCTAATCAAAGT
AGTCAAGGAGTGTAGTGGAAGAACTATAAGTGATGCCTTTGTTAGTTATGCATGCTAAGCATTCGTATTTACTGGCTATAAGCACTGAGTAGTCGCTCGT
CTATAAGAAAGCACTTTTTTGTCAGTGCCAATGCGTTTTCTTCAATCGAACGCTGGTTTTATTCATATTTTAACACAAAACGTTTATAACATATCATGGT
CAGACCACTTAATAAGGAATGGAAGCTCTTTGGTCAAAAGTACCACGTGGCCGGCGCCAAGTGCCCCAAGGTGGACTGCAAGGCCTGCCATGCGCAAGTC
TCAGCCGCCATCAATCGGCTGCAGTCGCATATACGCGTGTGTCCGACTCGTTCCGCCTCGACAGCTCCTCGTACAATCGCCAACAGCAATGAAGATGACC
GTTCCAAAAAAACGTGTTTGGACGAAATTATACCTCAATCGCAAGACGGTATTATCGTACCTAATCGAGTTGCGAAGGTGACAATAGCAAGTTCTCCACT
GGCAAAAGAACAGCATCAATCACCATCTGCTGAACGAAACGTCTCGACTGTAACGGATACGGACAACAGTTCTATCCATTCTATTGGAGTAGAAAAGATG
GCAACGGTACAAGAGGTAGCCACATTGTCGTACTATAAACGTCGAAAATTAGAGATCGAGGAGAGTCGACTACAGCTCGAAATTAAGAGAGACGAGCGGG
AAGAGCGTCGAGAACGACTGGAGGTGGAGATTCTAGAAGCACAAGCAAGAAAGGAAAAGATGCTCGCAGAAAAAGAAGGGTACGAGTCGAAGATGCTGCT
TGCATTATCGCGGAAGAAATTGCTGGATCAGGGAGTGGATCGGAGCGAGATCAACCGGATTCTGCCGATTGTTTCGAGCGGTCCGACAATGTGACTGCTG
TGCTTTTGCTGTGACCGACAGTGCTGCTGTAGCAACAACCACAACATACATATTCAGCAGCTGGGATACGGACCCGGGGCCATTGGCCCGGTCATGCGAA
ACTGACTGCTTGGTCAGCAGTGGTATGTTGAATACTTTGATGTGTGTGAGTTTAATTACTACGGTTAGTTTTGAAGTACGAAATAAGTTATGTTCACGCG
ACTAATATCAAGACAGACAAGTCACTGCGACTTTATGAGTCCATGACGCCAGCCAAAGGTGAAAAGTAGGTACCGAGTACGCGCAAAGAAAACGTAAGGT
TAGCCTCGCACTTTCAAGTATCTTTGTTTAAGGTAAATAAAGAAACCAGAATGCAAAAAATATAGACCGCAAGATCGAAAAAAATATCAAGGATGTCCAC
ACGTACGAATAAATAGACATCGTCACTGATTTTCATATACATGTCGTAGCGATTCGTAATATATTGGGTATTGCGGTGGTCTGGTGGTGTCAAATCGT