Description :
From Genome Similarity Track
Location :
contig_73:173024- 174192
Transcript NameFunction/comments
g9959.t1hypothetical protein

Sequence
1168 bases(100 bases per row)
TCACACCTTCAAAGTTAGCGTCTCCAGCCGAGATAAGACTTCAGCCTGGACCAACACTTCAACTTGGCCACTAAATTTGGTCGGCGTGGCCACGCCGCTG
GGAATAGCTCGCTTGATCGGCATGAGATCCGGTTCGCCCAACGACGGTCATCACGATCAAAAGCCATCTGGCTCTGCAGTCAGCAAGCCCCACCGTCTAC
GATGCAGGACATGGACTTGGATCTGCTCAACTTCGACGCCTTCTTCGGTCCAAACAACGACGAAGAGGTGGTGGGTAAGCGACAGCGGTCCCGAGGCAAT
CGAGATGAGGTCCTAATACATTTGTTTTCAGACTTATGGAACCTAGCAGCGACGACCGGACAGGAGGAGGATCTACTGGATGACGCAGACTTTGGGCCAC
TCAGCCCGATGCTGAAGGAAGAACCGCATGAAGAACAGGAGCACGCTCAAGTAAAGCAGGAACCGGGCAACAAGCACGGGCTGAAGCTGGACACGAACTT
GATCAATAGTTCGAAGGAAGGCTGGCTGGCCCAGTACGAAGCAGCAAAAACCAATGGCACACCTACAGCCACGCTGCCAGCACGGTTCGCTTTGCTCTCG
ACGACCTGCGTATATGAACCAGGCTTCACTACGTCACCTCGTGGCAAACGACGCATTAGCCAGATTCGTGGTGAAGCGTTTGAGATTCAACATGAAGTGG
AGGGAGAGGAGAGTGAGGCGGAAGAAGAAGATGAAGAAGAAGATGAAGAGGAAGATGAAGCGGCAGATGGAGACGAAGAACCATTTATGCTATCGGGAGA
CGACGACTATATTATGCCAGTGTTCACTGATGCCGAGCTCTCTGCAATGGTAGAGTCACCTTCGAAAGTCTCCACTACTTCGACCATTTCTCCGACCCCC
TCACCGTCACGTGGTCTCAGTGATGCGATGCATTATAACAACCTGTTCATTCCGGAAGCCCCCTCGACGGCGGATCCTGGTGCGCACGTGAACGAGCAGG
AAATACCGGACGTGATCAGCATGTTCAATTCAATCTACGACAGCTCGCAGAATTTCCTGTCGTCGCAACAGCAACCGTTTGATCTTACAGGTACGGGAAG
CAGTACCAATGCGAATATTCTAGCAGCAGCCAGTCAAGCTATGTTTACTACGGCAGTCCCATTCAATG