Description :
From Genome Similarity Track
Location :
Scaffold_1605:1730- 3288
Sequence
1558 bases(100 bases per row)
TTCCAAGTGATGCGCGAGAACAAGTTGTACGCGATCCTGAAGAAGTGTATCTTCTGCGCGCCGGAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAGGACG
GCGTTCGCGCCGACCCGGAGAAGGTGTCCTCTATCTGCGCATGGCCGACACCAAAGAATCCCACTGAGCTGTGTCAGTGGTTGGGACTAACGAATTATCT
CCACAAGTACACGAAGAACTACGCCGGACTGATCCAGCCCCTCTCATCACTCCTGAAGAAAGATGCCACATGGGCCTGGTCACCCGCTCATTAAGCCGCC
TTCGACTCAGTGAAGAAGAGCCTTGCTGAGGCGCCGATCCTAGCTCTTCCCGACGACTCGAAACCATACCACGTCGTTTGCGACGCGAGCGACTTTGCCA
TCGGCTGTGCGCTGATGCAGTTTGACGACGAAGGTCGTGAACGGGTCGTCAGCTATCAGTCTCGACAGATGAAGCCAGCGGAGCGCAACTATCCTGTCCA
CGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATCAAATTCAGAGTGTACTTACTCGGCGAGCAAACCTTCGCAGTGTTAACGATCACGCATCGCTGA
GGACAGCGATGAAAAGCCCTCATCTTTCCCAGCGAATGGCTCGCTGGTTGTCGTTCTTCTCCAAATACAACTTCGTGGCTCACTACAAACCCGGCAAGAA
CAACATCCTTGCCGATGCTCTGTCTCGTCGTCCAGATTACTACCCACGCGATTCGCTGGGACAGCCGCTGCATGATGAAGACGACGAAGACAACTGTGCT
ATGTGCTTGGCGTCGGGATTGAACCTGACGAGCGTGTCTCCAGAAACCCCACTCCGCGACGAAATCCGGACTGCGTATGAATTCGATCCGGTCTATTCGA
GTATTCTGGAACATCTCCGTTTGCCCAGTGAAAAGACACTGAGTGCTTTGTCCCGCTCCACACGCCATCAGCTCGACAGGTATCGGATTGAGGACGGGCT
GTTAACGTACATCATCGATCGCTTCGATGCTTCGCGTGTAGTGGTCCCCAACGACCCTGACTTGTGCTCACGGATCATCCATGAGTTCCACGATATCCCG
CTTGGCGCTCACTTGGGCCGTGAGCAGACATTCGCCGCGGTGTCACGCGACTTTTACTGGCCCCACATGTATAAGTGGGTGCGCAAGTGGGTGAGGTCCT
GCGAGATCTGCCAACGCGTGAAACCGTCCGCGTCGTCACAGGCTCCCCTGCGTCCCTTACCAGTGGCCACCGAGGCATGGCGCTCGGTGTCGATGGACTT
CATCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACAGGGTCAGCAAGATGGTTCACCTCATCCCGGTCCCGGATACG
ATCAACGCGGCCGATACCGCGGTGCACTTTGTGGATGCAGTCTTCCGTCATCATGACATGCCCGAGTCTATCGTTTCGGACCGCGATCCGCGGTTCACGT
CTGCTTTCTGGACGAAGCTCTTCGAGCTATCAGGGACAAAGCTGCTGGCAAAGGCGAC