Description :
From Genome Similarity Track
Location :
scaffold_4:173- 66657
Transcript NameFunction/comments
Pl_112864O-phosphoseryl-tRNA(Sec) selenium transferase, putative
Pl_112865eukaryotic translation initiation factor 3 subunit, putative
Pl_112866hypothetical protein PHYSODRAFT_492857
Pl_112867hypothetical protein PHYSODRAFT_492063
Pl_112868hypothetical protein PHYSODRAFT_313186
Pl_112869hypothetical protein PHYSODRAFT_313187
Pl_112870conserved hypothetical protein
Pl_112871hypothetical protein PHYSODRAFT_313188
Pl_112872hypothetical protein PHYSODRAFT_488619
Pl_112873ABC transporter ABCF family
Pl_112874hypothetical protein PHYSODRAFT_388544
Pl_112875hypothetical protein PHYSODRAFT_369743
Pl_112876hypothetical protein PHYSODRAFT_493289
Pl_112877hypothetical protein PHYSODRAFT_298656
Pl_112878DEAD/DEAH box RNA helicase, putative
Pl_112879hypothetical protein PHYSODRAFT_313194
Pl_112880hypothetical protein PHYSODRAFT_465114
Pl_112881hypothetical protein PHYSODRAFT_313196
Pl_112882hypothetical protein PHYSODRAFT_354318
Pl_112883hypothetical protein PHYSODRAFT_491293
Pl_112884hypothetical protein PHYSODRAFT_497615
Pl_112885hypothetical protein PHYSODRAFT_491946
Pl_112886hypothetical protein PHYSODRAFT_489198
Pl_112887hypothetical protein PHYSODRAFT_497365
Pl_112888hypothetical protein PHYSODRAFT_345503
Pl_112889putative serine/threonine-protein kinase
Pl_112890hypothetical protein PHYSODRAFT_313206
Pl_112891hypothetical protein PHYSODRAFT_259400
Pl_112892rasrelated GTPbinding protein putative
Pl_112893putative malonyl-CoA decarboxylase
Pl_112894hypothetical protein PHYSODRAFT_313210

Sequence
66484 bases(100 bases per row)
ATGAATTCAACGAGCGCAGGTTTGGCGGAGCGCTTGGTGCCAGCCACGTACGTACGCCAGGGTCTGGATGCGATTCGCGCACGAGAGAAGCAGATTACAA
CCCTGTTGGCCCAGCGCCGCCTCCCGGACGAAGGATGGGACGACGTCAGCGTGGAATTGCTGCTGCAGACGCTCTCGGCCATGGACAGCAACAACTTCAC
AGGAAGCGCAGGCGCAGGTGAGCGTGAGGCGCGCGTCTTCTCTCCTCTAGTGGCGCGCCGTCATTTCCACTTGGCGCATGGTGTGGGAAGATCGGGCGAC
GTCGCGGCGGTGCAGCCTAAAGCCGCTGGATCATCGCTAATGGTACAGGTGGCTAATGCCCTGGCCAAGGACGTTTTGCGTCTAGCAGGGATGCGAGCGG
TACAGGCAGCGCTGGTGTTTCCAGTGGCTACCGGCATGTCACTTACGCTAGTACTGCTGCAACTCAGGGAATCAAAGCCCAATGCACGTTACGTCATCTG
GCCTCGGATCGACCAGAAATCCTGTTTCAAGTCCATTTTGGCGGCTGGGCTGACGCCACTGGTGTTATCCAATGTTCTGGTAGAGGAGGAGGCCGGGAAG
ACTGGCGGGTATTTGAAGACAAACTTAGTAGGGATGGCGGCGCTGATGAAACAGTATGGGAGTGACAATATTCTGGCTGTGATGAGCACCACGAGCTGCT
TTGCTCCAAGGGCGTACGATAGTGTGAAGGAAATCGCCAAGCTTTGTCAGGAGTGGAGCATCGGTATGACGCAAATGATGCTGAAAATTGTTACTATGAA
GGACGGAGGCTGACTACATTTCGCTTGTGTTGGCTTAGCGCACGTAATTAACAACGCATATGGCGTCCAGGCATCCAAATGCGTTCATGAAGTAGAATTG
GCCATGCGAACAGGACGTGTAGATGCTGTGGTGCAGAGTCTCGACAAGAATTTCATGGTGCCTGTAGGCGGAACAATTGTTTGCTCAGCATCCCGTGAAA
TTGTTGACCACGTAGCAAAGTTTTACCCTGGACGTGCTAGTGGTACACCAACACTCGATTTTTTCATCACCATGCTTCAAATGGTGAGCGTGTCGATGAG
GCAGCGCAATCATTTTCTCGGCAACGCAATTGTAACTTTCAATTGTACTCGATTCGTGTGTTACAGGGGAAGTATGGATATCAACAACTACTTGAAGAAC
GCAAGCGCCTTGCAGGTTACATGCGTGAGAAACTCGAAGCATTAGCAGCAGAGGAGGGCGAGCGCGTGCTACACGTCTCCAATAACGAGGTGGGCATTCG
TTGGTCATTCGATTTTGCGTCTAATTATTTTTCATAGTAACGTGTCGTGTATCCAGATCTCCTTTGCGCTGACACTGGGGACGTTCTGCTCTGATGTCAT
AGACAAGCAGGAGAAAGCGCGACAGCTTACGCTACTGGGCGCGATGCTCTTTTCGCGTGGGGTGTCTGGCGCACGGTGCGTTTACAGCAATTGCAGATGA
GGGTACTACTGGCTACTGACTTTTGAGTTTCCTGTTCCAGGGTAGTGTCATGTCTCGATGTCAAGACCATTGCTGGTCACGAATTTAGCTCTTTTGGAGC
GCACCACGACGGATTCCCCGTGGCATACGTCACTTTTGCTTGTGCGATGGGCATGCAACTTGACGAGGTGGACCTGCTTGTCTCGAAATTGCGAAAGACA
ATTCACGAATGGCGAGCTAAGCAAAACAAGACGTCAACCATACCATCAGCTCCACATGAATCTCAACAAGGACAGTGTTCAGAACACGAGAACAACAAGT
AGTCTTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTCTCCTATTGCTCGTTCGTGTCCTATAGATGCAGCTGCTGTGCTGGGCGTGTTTAGTGTTTC
TTACCACCGCTCTTGGACTTGCGGTTTTTCTTCTTGGTCACAGGTGGCGATCCAGAGTCTTGGTCAGTCTTGGTCTTGAATTCAAGCTCTCCAAGAAGCT
CATTAGCGATGGCATCAGCTGCCTCTGCGGCATCCACTTCCCTGCGGCCCTTAGCACCCTCCACAGCCTTTTCCGTGAACTTAGCCATGAACTTAGCCGA
CTCAATCACACGCGGATTGTCTTCACCGAACGCCTCCTTGAACAGCGAGTACACCTTTTTCTCGTAGGCAAGTGCCTCACGGTAGCCGCCAGCAAGACTG
CACGCCAGAGCCATTTGGTGAAGCGTGTTGGCCGCCTGGTTGCGGTCGAATTCACCTCGACGGAGAGACTCGCGATGGCACATCAATGCTAGTGTAATTT
GCCCCACATCCTGGCACATCATACCCATCTTGAAGTAGAGTGAGCTGATCTCAGGAAAATGAGGGCCACAGCAAAATTCCAGCAGATAAATGGCTCGGCG
AATGTGAGGCACCGCAAGATCGGTCTGGGCATTCGCGTGCAGGAATAACGCCAAGTTCGCGTGCGCGTAGGCCGTGTCATGGTAGTCGATACCCTGGAGC
TGTGTGTACAGAGCCAGCGCTCGCTGCTGCTGCGCAATGGCACCAACAACGTCACCAGCATGGTAGAGCACAGTAGCAAGCGATGAGCTGCAGAGAGCTG
CGTCCTCGTGGGCCGCACCACACACCTGGAAGAGTAGACTCGACGCTTCCTGAAGGAATTCGTATGCACTCGACAAGGCACCCTGACTCAAGTGCAGGCG
GCCACGCTCAAGAAGCTGCTTAGCTTGTGCCAATGGGTGCGCAGGCAGTGAGGTCTTCACAACCGGCACAACACCAGTAATATCATCCAAGTTGATTGGT
GACGACGACGAAAACTCGTAGTTACGGCTCGTCACACGCAGGCCTAGACGCTGGCATAGACGTCGCAGCATGACCGACTTATTAACACGACCAAGAGGGA
AGGCAGCCTCCTCGCCACGAGATTTATCGCGGCCAAGGCCCCAAAGAGTTAACTTGTAGTCAAATCGGGCTTTGATCTCCGTATCAATGCGAGCCCACAG
CGTCTTGACATCCAATGAGGCCGTTGTAATCGTAGTATCGTTACCATTGGCCTCTGAGGCATCAGTCTTGTCCACAGTACCCGAATTCGATCCGATGATG
CCGTTCAGCAGCTTCACAATCGCTGATCCTGGAGCGGCACGGATGGAGTCGTTGGAGTTCAACACATCAGCCAGAATGTGCTTGGCTACACGCGAAATCA
TCTCCACCTCTAGCATCTCTAGCAAGTACTTGGAAATACCGCTAATTGCCTCGAGCTTCTTCGCAAGCGAAGCCAGACGACCCAGGTAACGCATGTTGAT
ACCACAAGAGTGCATCAGCTGTGTGAGAGCGTAGCCATCAGCAGGGGCGATTGCACCACGACGAACATCAGCCACAAACGCCGGTACAACAATCCGCTGC
AGATACTCAGCGGCATCTTTAGCAGCAGTCTCATCGGCCTTGATCTGCTCTGCATCAGTAGAAGGTGCATAATCCATGAAGACATTCGGGTTCAGCAACA
CGGGAGGAACATCTTCTTCCTCCTCCTCTTCTTCCTGCTCATTCTCTTCTTCCTTTTTCTCGTCTGCCTTCTCGGCGTCAGCCTCAGCACCGTTCTCCTT
TTCTTCCCCCGCCTTCTTAGCCTCCTTTGCTGCTTTACGTGCCTCATGGTTGGCGCGGCGAGCCTGGTTTTGCTTCCACAATGAGTACAACTGAACCAGC
TCCGGGCGGAGCAGAGCTGCATAACCCTCATCGTTGCGTGTGAAACACAGTCCGTCGTCCTCGGACTTCTCCTCGGTGTTTTTCGTGGCAGCATCGCGGT
TCTTGTAGAAGGTCCAATCCTTCGGGGTAATGCGGACGAGATCTAGGACATAAAGACGGCCGTCCGAACCCTGGATTCCCTTTGCCTCAACAGCACCACA
AATGGTTGCTACGTTTGTGCTTGCCTCACCACCACTCACTGGGACAACGCCAAGAGCCTCCTGCTCCTTCTCAGCAGCCAAGTCCTCTTCACTCTTACCA
AGCGGCTTGATGTTGCGCTCGGCAATATGCAGCTTTCTTCCTGCTTCAAGCATAAGCTTGTGCATCTTGTCGTTAGCAGCGATGGTTTTGCCATGATCCA
CTGAACCGTACACAAGCTTGGAGGCGGCGTCTCCCATAAGGATACCCGGGATAAGGCTCTGAGCAATGACGCGAACACCAAGATAGTCCACGACAGTCGT
GGCCAGGGTGTGGAGACCATGCACATCAGCCTCGTTAAACGCCTTCACACCCTGCAGGTCGCGGTTGGCAGCCGAGTAGGCATTCTCTTCACCTCCAGCA
GCATCCTTGGTGGACTTGCCATCGATGGACACCGAAAAGAAAATATTGTTGAAAACGTAGACATGAGCGCTCTTGTCGTCCATAGGGTTGATAGGAGGAA
TGTTTCCCTCAACGATGGCCACCGCACCTTGCGTCGCAGCCTCCACAAACTCCGTCACGATCTTGTACATGACACGAGCGCGGACGAGCTCGTCCTTTAG
CGAATCCGTCGGTAACTCGCGGCAGCACTGGTACTCCTCATTCCAGTCACGCAGCACACCACGCTCGTCCATACCATAGGTCGCGCAAAGCTCATCCTCA
GCACGATTGAGGTCGTACGTGTGCTCCCCCGTCGCTGCAGCAATAGGCGTGTTCCACGGCAGCTTGCCACCCAGGTTGGAACCAGCAGCGACCATCCACT
CGATCGAAGAGGGACCCTCCTTCGCCAGAGAGGCAGCCTTGGCAAGAAGCGCAGCGTAAGACTCCCTGAACTTCGGCGACACAGTACTCAGCACATCCAC
CAACAAGTGCGAGTGGGCCGGAGCAGTTTTGTGGGGACGCGAGTCGAACTTGGTGGCCGTCGAGCGGTTCACAAAGAAGCCGTTGACATGCGCTGTGATG
TGGTAGCGCGTGTTGTCACCAGCGACGATCACTTCTAGGTAAAGCAGATCACCCACCAGCTTGCGCGGTCCAGGAGGCGGGTTGTAGCCTGAAAACACAA
TGCTCTTGACACATGAAGGAAGCTTGGCGTCTGGCTGTTGCTCCTGTTCCTTCTGCTGGTTTAGTTCGCTCTGCTGCTGTTTTTGCTTCTGTTGGTTCTT
CTTTCCCTTCTTGTTCTTCTTGCCCTTGGCAGACGTCTCCGTCTGCTCAGTCTCTTCCTGGGCAGCAGTGATGGCACTAGGGAACGAGTAAAACTCAGCG
AGTTCAGGTACAACTGGGATTTCAATACCCTCAAGTTTGTGATGGATCTCACGCAGTCGCTTCAGCTGTTGCTCTGAGATTTCCTTGAGCTTTTTCTCGT
CCACTTCCTCGCCTTCTGCGGGCTCCTCGACCTTTTCTGCAGCTTCTGGCTGAGCCTCAGGCTCCGTGGCAGCCTGGGGAATGGGAGGGTTGCCCAACAC
ATCGCGGAAGCGACGCACCTGGGCGCGCACCTTGCGGGCGTCATACTTGTCCAGCACCATGCGCAGAGTGACGCCATCAGTCACGTTTTCATACTCTCCG
AGCTCCACGAAGTCGTTAAGAGGTTGCCAGGTGTCGTCCGCGAGGATCTTCGCTTCCAAATGGTAGCACGTGTAGCAGGCAAGCGCCGGGAACTCGGCGA
TGAGCTGGCGCAGCGCCACTACAGTGTCCGAGGGGCTAATGCTCTCGAGGCGCACAGGCTGGCCGCTCTTGCCAGCGGGGGGCGCCACTAGCACGCTGAA
GGCTGGCTCCTCCACTTTCAGGGCCTGTTCTTCCTGCTGCTGCTCCGGCTGCTGCTCGACAGTGTCGCTGCCCATGCTGACGAGGGAAATCTTGGCACTG
GGCTCTGGTGGATCGGGGCGAAATGCAAGTGCGTAGCAACGTGTGGTGTGCAAACCATGAGCCTTTCAAATCGGATAGGACTAGTGGAGGATTGAAGTTG
GCGCTTTTATGTCATCACACCTGGTGTTTGTAAACACCCATTAACCCTTGCATATTTCATGGCATGTTTGATTGCAGGGCATTTGATATTGGAGGTGCTT
CGCGCACCGGAATGCGCAAGTACATCCGTAGCACCAACGCTGGCCCCGCAATGAGCACTAGCATCCACTGCAGCACTCGAAGGCTGTTTGGTCTATCACC
AGCAATTGCGCTGCGATCATGACGGTCTCGATCGGCCTCAACGCTGTTGACATCTTTGGCCTGATCTTGTACCCATGTTTTGATGGATACCTCCAATCCG
TGATTGGCATGCTCATCGGAGCTCTCCGCCGCAGCTTCCTGGTGCCTGGATCCTCGTTATCGCGCCGTACCCTCGCTCCCTTCGCGCTCCGAGCCATGAG
TTCCGACGAACGATCCAAGGCCGATGCCGCGGCCGACTCAGGCGCTGCCGCCGCTGTGGGCGAGACCATCTTCGACAAGATCATCAACGGACAGATCCCT
GCTAAGATCGCGTACGAGGACGACAAATGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCATATCCTGCTTATCCCCAAGAAGCGCGACGGCC
TCACGCAGCTCTCACACGCCGAGGAGCGTCACGAGGCTGTTCTAGGCCATCTACTCTACGCTGCTAAGCTAGTGGCCAAGCAGCAGAATCTGGACAAGGG
CTTCCGAATCGTCATCAACGATGGAGAGGACGGCTGCCAGTCCGTGTTCCACCTGCATCTGCACCTCCTTGGTGGACGCAAGCTGGGCTGGCCTCCTGGA
TAAAGAAAACGGAGTCGAACAGTGATTGGAGTGACAACAAAGAAAACATGCTCATAGCATCAAGAGCAAAGCAAAAAATGGAGCAACAGTATTCTTGCTT
CCGGTATTTGAATGGGCTAACCACTTCTGGACTATCTTCGACCGCTGATCTCCTTGTGAAACTGGTCCAGGAATGTCTCCATGAAAGCGTGACGCTCCTC
GGCCAGACGTTTTCCTGCATTGGTCTTCATCATACCACGAAGCTTCAATAGTTTCTGAAATGGTTGCAGTCATCAACAACTCAAATAGTGAGAAGTCAAA
ACGTTGGTAGCAATGATTATCGGAAAATACCTCGTAGAAGTGGTTAATGGTAGTGTTAGGACGATTCGGGTCCATGTACAGCTCTTTCGTCATGTTGTCG
ATCGGAGGTACATCTGGGTCGTATAGCGGTCGCAGTTTGTGTCCACCATACGTGAAACAGCGCGCAATTCCGATGGCTCCAATCGCATCCTACACAGCAA
AAGCCTTTAACATCATCGTAGAAAACTTCAAGCCTGTTACATAACGTACCAGTCGGTCAGCATCCTGGACACAGCCATATTCAACAGAAAATGATCCCTG
ATGATTTCAACCACGGAGTCAGTCTTACAAATCCAACCAGCCTTAGTAGAAGGTAACGTACCGAGCCCTTGCCTTCCAGCTCCTCTTTGAACCCCATACT
ATCGATAATGGCCATCACGCGTTCGATCTTGTCGCTGGGCACGCTCTCCGACTGCAAGAAGGCCACGGCCCGCTTCGTAGGCTTCTCCTTGTCGCTCTGG
TACTTCCAGTCATCAATGTCATGGAGCAGCGCCGCCAAGTCCACAATCTCCAGGTTTTCCTCAGGCACGCGCTGCACGTGCACAAGTCAATTCTCCTCAG
GCACAGCCAATAGCTACAGCCGTAGACGCCATTGCACGCACCTCCTCCTTCGCCAGCGACCTCGCCACTGTCCATACGCGCTCAATGTGGCGCCAGTCGT
GCGACGCGTCGTTGGTCTTGAGCTGCTGCTCCACAAACGCCGCTGTGCGCTGCACCAGTCGAGATGTAGCCATCTTGTGGTCTGGCAAATTGCACACTGC
CAGTAGATCACGTCAGGAGGGATGACTCACCCGCCAATTCAAATTGGAGTTGCCTCCATTGGCGCCATAGCGCTTTCGTCTGTGATTGGTCAATAAGTTG
AGCTTCAACCTGTGAAACCCCTCAGTTCCCAAAACGCAGTCAACGTCATGAGCTCCCGATCGAGTTCGAGCCGCGGTCCAAGCCATGCAGCGGTCGTCAA
GGAGAAGCCTCGCAAGATCACAGCCAAGGCGGACGAGCTGGACGCCTACATGGAGAAGCTCTACGATGATGACGTCGAGTCCAAGCTAGATGGGGCCAAG
ACGATTCTGCAACTCGCAGAGTTCGCGGGCAACATCGAGGCACTCGTGCAGAACGAGTCACTCATGGTCGGTAGAGCGTCTACAGCTATACAGAACTAGT
ATAACCACTTCGTTTGTCGCTGTAGAGTCTGCTGTCTCGCGTGCTGAACGACGATTACAAGAAAAACTACGACTTTTCACTCACCATGATGCGCATTTTC
TGGTGTTTCTCCAACTTTTTACAGCTACATCCGATATTGGCTAACTATCGAATTGGAGCTATCACACTCAAGATCATCGAGTTCGAACTAAAGCGTCACC
AGCTACGCCTCGAAGAGGAGAAGATGTTGGAAGCAGTAGCCAACGAAGCGCCAACTGGCGATGCGGACGATATCATAGCGAAACTTGACCGTGAGAAAAA
GCGCAACAAAAAGCGCATGAAGAAGCAAGATCAACTACTGTGAGGATGCCAGACTGAGGAACGGTTTGCTTTCATTAGCCTGACACTTGTGATGGTTCTT
GTAGGTATGTGTGCTTTAGCGTGCTGCTGAACTTGGCAGAGGATATTCATACTGAGCGGAAAATGGTCAAGCGCAAGATCGTGTTGTTTCTGACGAAGGT
CAGTTATCGATATAACAATACGAGAACGTAACTAACATCGATGTTTGAATAGTTACTAGATCGCATAGCGCCCGACTTGGTCATCCTCACCATTACCTTT
CTCAAAAAGCTGAGCATATTTGAGGAGAACAAAGAAGCAATGGTAGAACTCACAGTGGTGGAAAAGCTTGTGCGATACCTCAACTGCAACCATGACAAAA
CTATCCAGACAGCCCTCAAGTTGTTGTTTAATCTATCATTCGACCCAGCACTTCGCGAAGTACTGGTGAGGAATAGCCTTATCCCGAAACTTGTGGACCT
ACTCAAGAAGCCTCCTTTTCGTGCGTTGTCTTTGCGAATTCTCTATCACCTTAGTATCGACGATCGATGCAAGTCAATGTTCACGTACACAGAGGCGATC
CCGATTGTCATGCAGTTGGTGATTAATTTCCCGCAGAATATTGTGGCGAAAGAGCTCGCTGCTCTGGCTGTGAATCTCAGTCATAATGCCCGCAATGCCG
AACTAATGTGCCAGAACCGCGGCTTAGAAGCACTTGCCACGCGTGTATTCCGCACCCGCGATCCACTCCTGATGAAGGTGATCCGAAACATCTCACTCTG
GTCGTACACTCTACAAGAAGATCTGGTCAGTGATAAGGCGTACAAGTATCGCGGCATGTGGGCTCCCTTCGTGGTACCATTCATTGAACTATGTCTCAAT
GCAGACAACCACGATTTTTCAATCGAAGTTTTGGCAACACTGGCCAATATGACGCCGAGTGACCTACCTTTGAAGACTTCTTGGGACAGATTAGTGACGG
ATCACTCGCTCATCCCGCTTCTCAACAAACTGTTAGTGCCAGGCTTTTCACAAGATGACATGATCCTTGAGGTTGTGCTTTTTGTCAGCACACTAGCGTT
GGAGCCGCGGTGTGCTCCACTGCTGTCATCGTCCCGAATTGTGCGGACATTACACTCGCTCTTTCAGGAAAAACAGCACGACAACGAGCTCACGTTGCAG
CTACTATATGCGTTCTACCGCCTGCTGAGGCACCCAGAGACGTTTGAAGATATCCTCTTTGGTGTCGGCTTCGTACCAGACTTGCTTCTGGCCGCTGATG
CACCTAATATTGAAGTGCGTCGGATGTGCGATGTGCTCATGGACTTGATTCTTGACCACGACCTTAGCGACGGTGGAACCATTGGTGACTTTGGACACCT
CATTCGACAGCGTAGGTTTGAAATACATAATGCTGAATATCTCGAGATGATCCACACTGAGACGCAGAGCGCAGCCTACCGCAAGTACCACGGAATGGAC
GATAACAGCAAAGATGACGACGATGATCACTGATAGGCATGATGCAGCTTCCTAGGTTATCACCTAATACAAGTGTACTTCAAAGTCCAAGTTAAATTCT
TGTCAGTGACAAGCCTTGGCAGTTGTCACTGATAGACAGCGTAATCTCTCGTAAAGTAGCTGCATCTAGCCAATGCTCTTCTTCGTCAAAAACGCAACCA
CACTCTTACGATCAATACCAAAGCGAGGAAGAGCCTTTTCTGGCCAGTATGTGTTGTGCTCACTGTTGATGGATCCCCCAGGTGGAATCACGTACATGTT
GTATGGGCACTCTGGTGAAATGGTCAACGCAAGCACTCGAGAGTTGTGCTTCCGTTTGTCTGAATAGCGAACAAGTTGTCGAACAAACTTCCAGTGATCA
TATGCAGACTCCAAGCAGAAAAATGCCATCGTCGATTCGTGGAGATTGCGGACCTCTGTCTCCATTCTTTCCATCCCCACCGTCCCACCCTGTGTCACCA
CGATACCTCGGCTCTCTGGAAATTCCTCGGGTGCCATTCCGTCGCGAGTGCGGCACCAAAATGCATCCACCGGAAATTCATGAAAGCTCTTTGTATCAGA
TGCGTCCTGGATTCGTATTAGGCATGACCAAGCGACGGAGCTCCTGGCCATGGGTAACTCACCATCAATCGCCATCTTCACATCGTCCCCGTCAACTGGT
TTTGTATCAAGACCGCAATCGATTAGGTCAATAAAAAACTGTGCTGCTCTCCACTCAGCCAAACGACGTGCATCCGCTTCTGTTTTCCATGTTGCTCGAC
AGAGAACGTGGTCATCGACTCGAACAGTACAGTGGAAACCAGGAGTCGAAAGAGAATTTTGAGCAAAAGGCGTGCGAGGTGGGTCTTCCACTGTAGTGAT
AATCTAGGTTTTTAACAGGAAGAGCAAGTTAGTCAAAACAGTAACAGCAGCACACGATTAAAGTTACGTACACTGGCTATGCCTGACAACTTGAGGTCTC
GGAACGAATCCATGGGCGAAACATAAGAAAGGGATTTTACGTCCAGAAAGTGAAGAAGCTGTGCCCAAATCGACCGGATCTTGTTCAGCTTGTTTAACAT
GCCATCGACAGCAGCATTGCAAGCATCAGACTTTACCTCCTCAGAGGTCTTGTAGCGAATGACGTCGTTGACATCGACAAGGACTTCAAAGATGCCTTCG
CGAAGACGTTCCATCCTGATATTTGCTGTAACATTAGGTATAATTCTTCTGTGCTCAGCTCCTCGATACTTCAATGATGCCCGAAGTCTGTTAATTCCAG
CACATAATTCATCTGTAGGAGTAAAAAGACTTCGAATTGCGGCGCGGAATTTGGCATCATCGGAGAGACCACTCTCAGATCGTTCATCATATTCCTTCTT
GAGCTCACTTTCAAAAGACGCTGTATGTTCTGCTACAGCAGGTGCATCCTGCGCTGTTTTAACCCCAGATGGATCCCAGTCATCATCGTCGAATCCTCCA
TCCGAGTAATTATCGTAGTCATCATCATCATCCATCTCATCGTCACTGCATAATATAAGATTTGACTTCTTCGCAGGAGTTGCTGTCGAAACACTCACCG
ATGCAGATCGTGGTGCTGTAGCAGCACCTGGTCTATTTATGATTCCATTCGACGAGCATAATGATGTTGATTGCATCTTGTTCAAAGACTCCAGAATGTC
GCGCCACCTTTCATTAGCAGAACGTTTCGCATCCTTTGCGTTTAAGCACGCTGTTGATATGGCTAGTGTGTCACGAACTTTTATGAAGTACATGAACATC
GGTGGAACAAGTTTCTCCAAAGCCGACACCTACGACAGATAATACAGACCATCAGTCATCTTCACCTTCAGTTAGTATCATACAGACAAATAAGCAAGTC
GTACCTTGTCACGGTTTTTCGCTTGAGTTTCATTACCAGCCATCAGCGTTGTCGGAGTTTGAGCAAGTCGGTCGTTGTAAGTTGCAAGCAGCGCCTTCCA
TGTCTGGATTATTCCATCCATCGTATTAATTAGAATTGAGGTCGCCTTGTCCTTTGCAATTTCCACAGATGGGCCTTCCCCACAAGCCTCGATCACACCT
TCAGACGCACTGAGCACGCATCTGATGAGATCACTTTGTTGCTGTGTTGCGGTCCGACAGAGCTAAAAGAATTACACACTGTCAAATCAGTCCTATATCA
ACTAAGAACCTCGTGAGCGCCTACCGTGAAACTGGATGAAAGCTTAATTGTCTCGGACTTGACGCTCAGATCCCACACGATCGCTTTGACTGCCCCCACA
ACCTTTTCTCTATCTCGGAAAAGTAGCATTAGCAGCTCCTGATACATGTCCGACTTTGCCTTCGCAACTTCATCTTCTGAGCGGGGACGGGTGTCACGGT
TGGGTTCTAAACCGCTTCGGTCTTCAACGAACAGGTTTGCTGCGTCCGCACCAGCCACGTCACCATTGTTCCCCTCAGTGTATCTCCTCTCAGGCAGAAC
CGGTGTTTGTGGTTCTGGTGCTGAATATGACAGGCGCGGACGAGGAGCACCACGCGCATCCTCGTGATCTTCTTCTGCATGTGGAGCATATTGTCGTTTT
CGCAGAATACCCATAGATCTCAACTCAGCGTCCCTCTTACCATTAGTTTCAACACTCTCAGCGCTTTCACACATCTCACTATAAGCCTCCACTTCACTGA
GCTCAGCATCCTCTTGTTTAACCTGAGCATTCTCGCTTGTGCTTTGTTCAAATTTGTTCTTGATCTGCTCTGCGTGATCCCGTGTCAGACTTTCTTCGTG
CTGGTCAACTAATTCCATCAGGAACGTCATCAGAGCGTTCACCACTTCATTTCTTGTGTCTGGGAGATGTGAGCCACGTCTACAAACAAGAGGAAATTCC
TGGATGTGAGCTACTACATCATAAATACCGCTGTCGGGTCCTCCATTGCGTTTTTCGTGAAACTGTGCAGAACAATAGCGCAAATTAGCTTCATGGATTC
AGTGACAGATCTATCGCAAGCGTACCTGCACGATTTTTTTACTTATGAGATAATTGAAGGTCGCATCCTTCACTTTACGGGTGTCATTTGCTGTACAGAA
ACCAAATTGAGACTTCAAATACGATAACATGTTGCCGTACAGTCTTCGGTGTTCGCTCACTGCTCTTGTTAGCCGTGATAGTGCACCAATAGTGGCATAT
CGATCAAATGTGGCAGTGGAATCGAATGACAAATGCCCTAATCGGACACGAGCAATATACTGGGATGACTCGGTCTTCCGTAATTCACGCCGTAGCTGAG
GCAAAAAATAGTCAGTCGTAGTAGCTCGACCATTTAAGAAGCAGGAAACGCACCTTAAGTCCTGCAGCCAATGTGAATTCCTTGCTCATGGTCATCAACG
GCACAGTTTGAACAGCAGTTGCTAGCTCTTGAAGTGATGACACGAGATCAACGTTAGGGCTAACCAATGCCAGAAGATACGATCGGCCCTCATCAACACC
ATAAGTCCTGGCCTTTATTGCAATACTAACTCCATTGGATTGCCCCTGTTGAATTCGGGAAGGGGATGGAGCCAATGTTGGGCCTGGACTCCCAACAGCC
TTAGCGTCAGTAGGTCCAACCTGCTCAAGAGCAGCACCCACTGCAAAGGTCACTCGTTTCTTGGTAACAACAGTTGCTGGACCCAACAGCGAGTTTGTCT
GACGTAAAATGGAAGTAGTGTTCGTTCGAACAGCAACATTATTGTTGTAAGCATCGTTTTCAGGATGCTCTGGACTCACATCAACTGTCATGTCCTCTAC
AGGATGTTCCAGTTCCTTCTCAGATGCCAAGGCAACATCCTTGCCCACATGGTCTTCCTCACTTGTGATCGCTGCATACCACTTCCGAAACTTGTCGGTA
AACTGAAAGGTTTTGTTTTCCATCAAAGTATTTCTCGTGTCGCCCGTCATAATTTTCACATACATGAGCAACTGCTTGGCCGAGTTCAGTTTTTTCACAG
CCCCTCGATCCTGCTGGATGATTGTGCCATACCGATTGACTAAGTGCTGATGATGTGTCGATATCTCGTCCAGGACACGTAGGATGTGTCCTGGAGTGCG
TCCTTGTCTCGGATCCGGCTGTACCGACGCTCCCATGCGAACAAAGCGCAGCACCACCGTCCTCTTGGTGGATTTATCTAGTTCCTTCTTAATAGTGACT
TGAGATCCCACAGCCTTCACCTCCTCATCGAGCTGCTTTATCTTTCTTGGGCAAATGAGGAAATCCTGGTCTTCCATTCCCACTAAATAGTCGTCCTTTT
CGACAGTGCAGATGGAGGTGTTGGTAGAAGATCGTCCAGCCACTTTGTCCGCGAACTCCATCGGATACTGCGGCGACTTGATTTCCTGTACTTGAAAGAG
ATGTGACTTCATAATAGAGGCCACTGAGAGCCCCAAGTGAGCGCCCAGCTGCAGATTGTCCACCGAACCGCGAGGCAGCGTGTAGCAGACCTCGTAGGCG
CGACCGAGCGACAACAACTTTCGCGTAGCTAAAGCGACCTCCACTCGCCACAGACGCACATCCATGTCAAACGCCAGCGCTTTGTTAGGCTCCATGAGTG
CTGCCGATGGCTCGGAGCTCTCTGCGAACGGGGCCATTGCTCGTCGACTTTTGGCTACTTCGACACTGGATAAAAACCTCTGAAAGCAGAGTCTGCGAGA
TTTCATAAATTATGTAAGGATAGAGGTAGGACAAGCGACTTCAACGAGAAACTGCGTTAGCTTTGCAGGATCCATTGGCTAGGAGAGTAGCAACAGCGAT
AAACTAGTGTCATTTGCATCGATTGTTGATGGCTCATCAAGACGCTACTCCATGAGGAAAATGCGGCTGGCAACATCACCGACGAGCCAATCGATACCGT
CGACAAGGCCACTACCAGTGACGGCGCTGCAGGAGATGATGCTCCAGTGTCGAGTAGAGAATTGAGCCGATCGGAGTCCGAGCGCGTCTGCAATTTCTGC
AGAAGAGAGAGCGCCAGGTAAATCCTGCTTGTTGGCGAAGATCAGCAGTGTAGCTCCTGCTAGTTTCTGGAGGCCAAAGTCGAGGAGTGAAGCAGAGGGA
TTAGCAGTGAACCACAGGCAGAAAAATAATACTGATAGTGCACGCACCTCTTGAGCCAGCAGGCTTGTGAGCTCGCGCTTGCAGTCGTCAAGTCTCCTTC
GATCAGCGCTGTCTACCACCCACACGATACCATCCGTCTGTTAAATCACACATAATTAGCTCGCCACTCCTACACATATGCAAACAGTAGATCGAGCCTG
CTCAAAGTAATTCCTCCAGTACGACCGAATTGTCTGCTGGCCACCAACATCCCACACATTCAACTTAAAGCTGGCAGTAACATCAGTTAATAAGTCTCTC
ACGACCGACTCGTGGAAAGTATACCCACTTACTCCTTGTACTCGAGCGTCTGGATGTCGAAGCCCAGCGTCGGAGAGATTTCCGTAATATCCTGACCCAT
GAACTTTTTCAGAATTGTCGTCTTGCCAGCATTGTCCAGGCCGCTGGGGATCGAAATCAAGCCATAGTAAAGCCATCAGCTCCAGTCAGTTAGCGTCCTT
AGAGCCAAGGCAGCAACGTACAGCATAAGCACGCGGATCTCCTTCTCTTTCTCCTTGACTTTCTTGAGGATACTCAGCAGCCCCATGACATCGAAATACA
CACTTGGGACGTTAATGCGATATTTACGTTTGATTTTTACTGCAATATTCACGAAAAGACACGAAACGACAAGAACTTCAAGCAGTAGACGACGAGTAGC
AGTAGTCGACATGACCAAGGGAATTCCTCCAAGACACTCGCTGTTTAAGAGACGTGACGGCAACCAGGAGGATGCGCACGCGCTAGAGTCCAGTGCTCGG
TCTTTGAAAATCCACATTCCACTGCAGCAGCAGCAGTCTCCAGACCAAAACGAAAGGCGAGATTCAGCCAAACTGACGCCACTCGAAGCACTGCTAGATT
TGGAGCTTGACTTGGTTCTTCCTGCAGCTGCAGTACCTGCACCAGTGAGTAATCAGTTGACAGCTTCAACAGCGAGGGATAAAGAGCTGGCAACCAACAT
CGATGCACTTTCGTTGGAGTTCCTGGTGAGAGTGAAAAACGCTGTGTTCAATCATCGACGATGCCTCATTTTGTTGTACGTTATGCTGCTACAGGCACTA
CAGAGTCCACACGGCGAGAATCAACAGTGGCAAAGCGAAGAACAAGAGCAAGATGTGGACTTGATCCGACCAAATCAACCAGAACACTCCCCACGTAGCA
AGACGAAAGAAGCATCTGCTCCTAGAAAGCCCATGCGACTGAATATCGTGTCACCGACAGGGTTTGTTCCATCATTCCCTCCTTCCTTCTCTCATCCGTC
AACAGATGACGACTATGGCTTAGCGTCGCCCATGGCGCTTCCAGACACACCGTCGCAGGGACGAACAAAGCTCACTTTGGCATGGGATCTTGAACCAGCT
TCTCCTACACTCGAAGACATACATGCAAGGGGAGATATGTTCCACCGTTTGGCACAGTCAAAGAGCGTCCAACGACCAAAACGTCGAGCATCATCATTTT
CACCTGCTGTTAAAGCTTCCACACCAAACCCAAAAGGTTTCGTACCGGAGAGAGCTGCGTCAAGGATAACACGATCCTCGCTTCCAACGCTTCCAGAAGT
TCGAAGCAAGGCCAGGCACGGTGGGATCTACTCGTTGCTACTGAAGAACAAATCCGATAAACAGGAACCGGTCCTCATAGAAGACACACATAATCCAGAA
GGTGCCATCTCACCTCTTGTCGGTACGATAATTTTTGTTCTAACTCATGGTTTGGACTGTACTTGTGTTCTTCAGAGGTGACGGCGGTCCCATCCGTATC
CAAGGTGAGTACGTATTCAATCTCTTGCTTTCGGCAGGACGCACTCACGACCATTTGTTGTACAGGGATCACCTCCACGCACATTCAGCAAGCAAAAGCA
CGGCGGAATCTACAAAATGCTCTTAACTAATAACGAGCCTCGCTGTACGAAATAGACACTGGCAAGGCTAGGAACCATGCTTACTTTACTGGTATTTCCT
AGACAACAGGAGGTTGCCTTTAGTATGAGATCGTCACAATTTACAGTGGCCTCTGGATGATCGCGACGAACTCTGGTTTGAGTGACGCTCCTCCAACCAA
AACTCGTCGTCGCGCAGGCAGTAAGTTGGTCCAACTTACTGCATCACCGATCCGATAATATCTAATGTGATCCAAACCCGCAGCACTACGGGGATTACTA
AAACGTGCACGAGGAAACCACCAGTGAAGAGCAGAGGTAATCTAGACAACAGGTAGTGGATTTTTTGAGAAATGGCTACATTTTCCTATCACTTTCCCAA
TTGAGCACATCTAGCAAGTCACACAGATGAATCGCATTTTCGGCAAGAAGAAACCCGAGGCGCCAGCCGTCAACATATCCGATGTAGGGGGCAAAGTGGA
CGCCCGTGTCACCGACCTGGACATGAAGGTGCGGGTCTGTGGCTGTAGCTATGTGAGACGCAGTAGGTGCTGACTACTTGGTGCCACCACAGATAGAGAA
GTTGGACCAGGAGCTCCGCAAGTATCGCGAGCAGATGAAAAAGACGCGGGGTCCGGCTGTCAACTCGATTAAGCAACGAGCCATGCAGACGCTCAAGCGG
AAGAAGATGTTTGAGGCGCAACGCGACAAGCTGCAGGCTCAGTCTTTTAATATTGAACAGGTATGGAGGAGCAGTTCACGGATTATCACAAGACTCTCAT
GCTCTGGCTTGTGTTATGATCGTTCGTAGGCCGCATTTGCTATCGACACATCGAGAGACACAATTAGTACGGTGGCTGCCATGAAGAGTGCGGCTGTGCA
GCTGAAGGCGGAGACCCAGAAAATCGACATATCGGAGCTGGAGGTGGGATGGACAGAGACAAGATAACACAATACTGAGCTGTCCAATTGCTAATGGACT
TTGCTTTTATTTTCGCGATACAGGACGTGCAAGATGACATGGCCGACCTGATGGAGGATATGAACGAGATCCAGGAGTTAATGGGTCGCTCCTATGGGTA
CGTGGAGGGCATCCCATTGATGCAGTAATATTGCTATGGACAAACACCTAACTCTTATGATATGAATGTGATGCTGATTCCTCGCGTTGCAGCATCGGTG
ACGAAATTGACGAAGACGAGCTGGAAGCGGAACTAGAGGGACTGGAAGAGGAGTGGGCCGAAGAGGAGACACTCGGGGAAACAGAGGCGGCACCGTCCTA
CTTAGCCCCAGCGCAGCACCACGAGCTGCCTGCAGCACCCTCCGGTACCTTAGACTCTGGTAGGACGGCTCGCGTCACCGACGAGTTCGGTCTGCCCGTT
GCGTCATACTCGACGTAGGGCCAGGAAGTAGGACGCCACTTTAACAATGGGAGAGATGGGTACAACCACGTCAGACGCGTCAGCCGAGGCACGCGATTGG
CCGAGCTTAGACAGCCAATCGTTTCCCGGAAGCAAATTTGGCAGGGTGAGATCGGCTTCAGCAGGGTATGTATTCTAGTCCAGATTTAAACAATAGCTCG
TAAGTCGTATGACACTCAAACAAATCATTTCTCAGAACAGTCGAGGTTTTAACCGTGCCGAGGTTTTATCTTCGCCACGCATTTGCTTGGCTCACTTTGG
TATTGGTGGTTTTGGTGCGCAGCCTTCAGCAGAGGACAGACCACAGCAGCCATGGCTCGCGAGAAGAAGGAACCACGTGTGAAGAAGGAGCGCAAGGGTA
AGAAGGAGTCGCGTAAGAAAGCCGCTGATGAGAAGAAAGCTGCTGAGAAGGCCGAGGCGCTCGAGAACATGTCACTCGCCGACCGCCTCGCTGAGGAAGG
CATCATCGCCACGTGCTCGCACAACGTGCGCGGTGTGCACAAGAACTTCAAAGATATCAACGTCCTGAACTTCAGCATCACGTACTTCGGTAAGGTGCTC
ATGGAGGAGTGCGACATCTCGCTCAATTACGGTCGTCGCTACGGTCTCATTGGCCGCAACGGTTCCGGTAAGTCCACCTTCATGAACGTATTGGGTGCGC
GCGGTATCCCCATCCCGGAAAGCATCGACATCTACCATCTCAAGCATGAGATCGAGGCTAGTGACATGACGGCACTTGAGGCTGTGTTGTCCGTTGACGA
GGAGCGCAACAAGCTCCAGGCCGAGGCTGACGAGCTCTCGGAGCAGATGACCGATGAGTCCCTTAGCGAGGAAGACAGCGAGGCCATCTCGGACCGCCTC
ACAGATCTGTACGAGCGTCTCGACGACATGGACGCTGCTACGGCCGAGGTCCGTGCTCGTCAGATTCTGTCAGGTCTGACGTTCTCCGACGCTATGATGA
ACAAGAAGACTAAGGAGTTCTCTGGTGGTTGGCGTATGCGTATTGCCCTGGCCCGTGCTCTGTTTATCCAGCCGACGTTGCTGCTGCTTGATGAGCCGAC
CAATCACTTGGACATGGAGGCTGTTGTTTGGCTTGAGGACTACTTGTCGAAATGGAAGAAGATTCTGCTCATGATTTCGCACTCGCAGGAGTTCATGAAC
GAAGTCTGCACGAACATCATCGAACTCACCAACAGAAAACTCGAGTACTATGCCGGTAACTACGACACGTACGTTCGTACGAAGGCTGAGAAGGAGGAGA
ACCAGATGAAGCGTTACAACTGGGAACAGGACCAGATCAAGCACATGAAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCTAAACTTGCTCGTCAAGC
CCAGAGTAAGGAGAAGACACTGGCCAAGATGGTTCGTGAAGGTCTAACGGAGAAGGTCGAGAAAGAGTCAACCGGTGACTTCAAGTTCCCGAACCCCGAG
CCGCTGCCGCCTCCTGTGCTTATGTTCCAGAACGTGTCGTTCGGTTACCCGAACTCTCCTGTGCTGTACTCTGGCGTTGAGATGGGTCTGGACTTGGACT
CGCGTGTCGCCCTTGTTGGTGCCAATGGTACAGGTAAGACCACATTGCTGAAGCTGATCACGGGAGACCTGGTACCTGTTGCAGGCAACGTTCGACCACA
CAGCAAACTGCGTATTGCGCGCTTTAGTCAGCACTTTGTCGATGTGCTGGACCTGACGCAGTCGCCGCTCGAATACTTCCGTTCGCTCTTCGGAACTAAG
TCTGTTGAAGAGGTGCGCAGCTACCTGGGTCGCTATGGCATCACCGGTGAAGTCCAGACACAGATCATGGGTCAGCTTTCTGACGGTCAAAAGAGTCGAG
TTGTGTTCGCGTACATGGCCCAGCAGAATGCTCACATGCTGTTGCTTGATGAGCCTACGAACCACTTGGATATGGAGTCTATTGATGCGCTCGCTCGCGC
CATTAACAACTTCAAGGGTGGCATGCTGCTGGTTAGTCACGACATGCGATTGATTTCCCAAGTCGCCAAGGAAATTTGGCTTGTGGAGAACCAATCCATC
AAAGTGTATCAGGGCGAGATTTCGGACTTCAAGATGCGCGTGCGTAAGCAGCTTAAGCTCGCGGACAAGGAGCCCGTCAAAACTGACGACGAGTAAATGC
TCTCGGCAGAGATCGCTCATTAGATGCTTGCTACATGTAGAACTGCTGCGGTGAGTGCCGAGACCGGCACGCCGTTCTGTTCATATTTGATTCACCCTGC
CGACTTGGTAACACATAGATTGGAAAATCAATTGTTGGTACTTGATGATAGCGTTATTTATGCATGAGATCGATACGGCTGGTTAGTTATCGTCAGCTTG
GTTGTTGTCTTCGTCAATGTCGTGCTGATCAACCTCATGAGTACATCTACTGAGACCATCATGATCGAGCTTGCTGATTCTCATGGCACTGACAGCACAG
TGAACAACTGAATTTCGATTGCTAGGTTTGTCATCTTCGTCGTCTGTATCATCACCATCACCCGTTAGATTGCTATGTAGTCGGTTTGTCGTGTTACTGA
AGTTGGTTGCTGACAGTCCACTTGATAAGCGACTAATCCAGGAATTACTACTGGCTCGGCTACCATTGTGCTTCCGAAACAACTGCTGGTAGTAGTGTCG
ACCTGCACTTCTAGCTCGATTGAAGAAGCGCAAGTGTTGATTATCCACGAGAACACAGCCACAGCTAGCGTCGTCACCCAAACCATGATCCTTGGACGTA
GAGAATACAGTGATCACGCGTGCCGAGTTACTGAAGGACAACCCCTCTCGAGTTGCCTCATGGGCTCGCAGGATGCGAGAGAAGCCATATCGTCCGAGGA
ACTTGTCAATTGCTCGGGACCCAAAGTGTACCGCAACACCACCACGTGGACTCTTGCCAAACCCTCGCGAGTCCAATTTCCAGTAATCGTTTTTCTCCAG
AGCGTCTTCGTTTCGCACGGGGTCACCCCATATCATGTCCGCGATCATGGAAAACTGCGGTTTATCGGTGTAGAACGCAACATCCAAAGTGTCTAGCGAT
GCTATCGTTGGTAATTTAGCGATCGTCTCGAACATATCCTCGCCTTCATCAATCGGACGGGGAATTCCTCCGTGCACACAGAAAACGTCATGGTCGATGA
TGGCAGCGACGGGTAAACGATCAAATGCGTTGTTAATTTGATCCCAGACAACACCGCCTTCACCAGCACCGAACCGAGTCTTGCACTGAGCGAGTAAACA
CCCTGATCCGTAGTGTGCTTCAAGTCCGTTAACAGCACGCGTTTCGTGATTACCTCGTAGCAAGAAAACTTTTCCAGGGTAAAGAAGTTTGTGCGCTAAT
AAGTAGGCTGTGCACTCGAGAGACGAGCTTCCGCGGTCTACATAGTCACCGAGAAAGAGAAAGCTACCTGCTGTAAGCTCCAAACCCAGAGGCCAAATGC
GTTCCGCGAAGAAGCGCAAGTCTGTCCAGTTGCCATGCACGTCGCCGAACACATATACCGGGCTAGATAAATCCAAACAGCGAGCTTCGTGCTCCAATAG
TGCACCAACCTGAGTACTTAGTTCCACAATGTCAGCTGCAAAATGAAGAGAACGCAAATAAGGCTGTGTCGTCGTCATGGAGTCTGCCAAAGCTGCAAGA
ACTCGTTTCGCAACCGCAACTCCTGCAGTAGCAGGAACTGGAAAAGATCGTAGAGATGTCAATACCTGTGCCGACTTGATGCTTCCCAAGCGATCGATCC
GTCCAGAAGGCGTCACACCCGAGTCCGTGATTGAATACACCATTGGAACGAGAATGTGCGGTGACGATAACGGTGGTTCTGCAACGACTTGGATGGAATC
GACGCCAGTGGCAGAAGTAGTGTTAGGGGATGTCGAGCAGCTTGAACACATCGCTGACGCAAGTTGTTGCTTGAGATATGCGATCTCCTTGTCCGTCTCC
AGCTTTAGAGCTCCGTATGAGTCGCGAAGTTTCTGTAAGCACAAACCCAGTTAGCCACTGATCTCTCAACGATACGAGTAACTATCATGCACCTGAAGTT
CTCGCGCACTCTGTTCTTGACGAAGCAAACACGCCTGAGTGCAGCTTTTTACTGAGACGCTACCTGGAGACAGGATGTCTGGTGGATTGATCAGCTGGGA
ACTGTTCTGGTCATGCTGGTGAAGATGGTCTCCGAGACTACAGCTCATATCCGTTTTCTGTGTGCTGCTTATGAAGGCGCTCACGATAGTGGCATCACCA
CAGCGTGCTCCTCAGTGTCCTCATGACACTGGAAATAGACGCATGGGATGTAGCACCGAAGTGATCAGCAACGAAATCTTCGCGAAGAGTCATGACAGGA
AGGATGAAATGGTCCCTAGTGCTGTTCCTCAGTCTTCTTCTCCTTGTTGGCTTCGAGTGTAGCAGCGCAAAGACCATCGACTATGACGCGCTTGAGAAAG
CGTGGGAGACCGGGGATGAGGAGCAGGAACTGCGCACGGAGGGAAGTGAACATTATCGGCAGCTTACAGACAAGTGAGTACAACCTACGACACCAAGTTC
GATGGACAAATACTTACTTTTACTGTTTCGAGCATCTTTTAGGAACGAAGAGGAAGCGAAGGCACTTGGACCCCAAATGATATTTGTGACGATGAAAGAC
GATCGCGGTGAACCTCTTCCTGACGTTGCGTCACGGTGGAAAGAGGTACGTGAAGCACAGACAGCAACAGCATTGGCATATACACTTACATATGTGCTTG
TGTTGTCAGATGCTTTGGAACGGTGGGGTCGATGTGAACATCTACGAAGTCGCCGACTTGAAACTGCTCATTGGGCTGCAGAAGGGGATCTTCGTAAATG
ATGTCATGAAGTTCCTCGGTGACCAACACGACGTGATGGAGTACGAATGGAATGGCAAAGCGTATTCAAAGCACATCGACCACCACAAGGAGACTAAAAA
GACCCGACGAAAGAAAGTGAAGACGAACGGTGCTAAAGGCTCAAAACATAGCACCAGCAGAAAGCACCCACATCGAAAACCAGCTCAAACTGCATTCACT
GCGGAAACTACGAGTTCCAAGCCGACAGAAAAGAGCGGGCTGACTGATGAGTTGTAATTTATCCTAAACACCATCAAAATGAAATGCCAAGCTGAGATGT
CGCTGGATGCATCGACGCGTTGTTCCAGCCACAGCGCTCTAGCAACCACGTGTTAGACCAGCTCAGTTACCTGTACGCTCACTCCGAATGGTTTCCAGCA
ACGGGCCCAGCATTTTGTTTTTCTTCGCATTCTCCATCACAGCATTCAGTCTCGGGTGCGAATCTGCGTCACGAACAGCGCTGATCGCATCGAGTGCACG
CAACGCGCTGCGAATGAGATCCTTGACTCGCTCGACCTCTGGGCCAACCTGGTCTTCCTTCACTTTCTTGTTGATCGTCTTCTCTAGCGGTTCCATCAAT
GAATCCAGTGCTCCAGCAATACTACCAGGTTGCACATAGCAGATCTTGATCAAGATTTGGTGACTGAGCATTTGGATATCGTCCTGGTCTCCCAAACCTC
GCTTCAGCTGATCAAAGAATAGGCTTGTGTCGAGCTGCTGCGGCAGCATCTGGATTAATGTGTCCACACACGAGTACGCAGCCTTACGAAGAGGAAGGCC
GTCATCCACTTTGTGCTTGAACGGACCAAGGTCAACCACGCGCTCCAACTTTATCTCAGTTGATTTTAGGAGCACGGGGAAGATTCGCTCGCGAACGTAT
GGCACCAGATAGTGCGCGTGGTGATGGGCAGCTGTGTTGAGCACAAGAAGAGCCGCACGACGCACGTGTAGGTCTTCATCTTCAAGGGCAGCCAAGAAGG
GGTCAATGTGAGCAAAAATCTTATTGACTGTTGACTCCTGAGCCGTGGTTGTCATCGCGTACTTCAGGCTCGTCACGGCAGTCCAACGTGACCATACATC
TGAAGAACCGCACAGCTCCGTCACAATCGGCATAATCTTCGCAGTGTCCGTCACAGCGAGCTTTCCCATGCATTCGCCAACCATGTTCCGCACGCCTTCT
TCTTGGCGAGCACTCATTTTCTGAAGAACCGGAAGGACACGGTCCACGTACATCGCGAAACCGTGATGAGGCTTTGCTGCGTGATCCGATATGACTTCAC
GGAGCGACGTCAGCAGCAAGTAGGAGTTTTCTCCGAGCTCTAGCTTGACCATAATGGTGTCCAGGTATTCTTCCATGTTGCCGACACAAATACTTCCAAG
CGAGTGCGCGGCAGCGGCCTTCACTTCTTCACCCACATTATTGAAGCACTTCAGAATGGTCTCCTTCACGTCAGTATAGCCTGCAAGCTTGATCTTACGG
CCGAATTCGCCCAAACAGTAGAGCGCCAAAACTTTGTTTTTTTCGGACTCAGTTTGGGTTATGTCGCCAACAAACTTAGCGAAAGCCAACTTTCGGTTTT
CTTCCGTCGTAGCCACACATGTGCCAGCAACGCATCGAGCAATGTTCAGGACCGAGTGCTTCGATTCTTCAGTATGTGTAGCCATCAGCGCCTTAAACAG
CTCTGTAAAACTACTGCCCGGTGAATTCAGCTGTGTTAACTGTGCGAAAAGGCCCTTAAGAGCGTCTAGCGTCGGGCCCTGAAGCATGGAGCTATGGCAT
AATTCCAATGCCTTAACTTGAGCGTTCAGCAACAAAGCGTCCGTCGAGGCAACGAGTGGGCACACACGGATAGAGTTTGACACCAACGTAATGCTCATTC
GGCACAGCTGGAGATCCACGTCGACAAGAAGAAGAGAAGCTTCTAACACCACTTCGCAGTGAAGGTTCTCTGGCATACTAGCACCCTTGTGAACAACCAG
ATCATTCAGGGTAGCCAGCGTCGCTTGCTTCAATGTGCGAGACTGCTGGCGAAGTAACAGGGCAAGAGATTGAGTACACTCCATAAGAATGGGAGACATA
TCCAAATTGAGCTTGGAGCGAGCAATCACCCCAATTGCCTTGATACTTTGAACTCGTGTGATTTCGTTATTGAGACGCTCCATGAGTAAAGGGAACACTT
CTCCAACTCGTGGACCAAGCTCGTCACCTAAAGTCACAGGAACACACGTTAGGAACACAATTTTTTGACAGCTGACTCACCAACAACCGAGTACGTTACG
CACCTAGAACAGCAACGATTTCTCCAATACTGCTGATCGCAGCTTCCTTAATTTCTTGGTCAATGTCATGCGCCTTCAAGTTAGGCAGCACTGCTTCGAA
AAAAGGCACCGCATATGGCTTGTACGTCGAATCTCCATCGTCAGAATGAATGAGACTAACAAGAGACTCGATCAGTCCAAGCGCTTTTGCTACCGTTTTG
TACCAATCTCCCTTTGCGCACTGCACTGCAACATTCACGATCGATTCAATATGCAGTTGGAACGGCTTTACCGTATGTGTATCTACGAGCAGCCGGAGAA
ACAGGAGCGCATCCAGCTTTAAGTCCGAGTGCTTGTCCTCCACCGCATTGAGAATATTAGGCATCAAACGTCCAATGTAGTCTCCCAGCTTTCCATGTTC
CACCATCGCCAGCTCACTCAACATCGCAACCACGGCACAACGCGACGGAACTGAAGCCTTTGTGCCAAATTGTTTGTTGGCTCCAACAATAATGACGTTT
AGGCGTTGTTCCAGCTGGGTAATGCAAGTGTTAGATGTTGGTGGGTGGAAAGAACCAGTTCCATTTGAGCTCGGGAGAGTCTTGCGAGTAGCGCGAAGTA
AGTCGGCAAACACCCCAAACACATCAATCCGAACATTCTCTTCTCGCTCCTTGAAGCGCGAGATCAAAAGCTGAACACAGTGAATGTAGATATGCTCCAG
AAGCTCCGACCTTGTTGTAATGATTGCTGTAAGAACGCGAAGACTGGCACGACGAACCTTCCAGCTGGTATCGTCATCATCACTGTAATCACCTTCATCG
TCGCTATATTCCTCCTCTTCTTCCATGTCTTCATCTTCATCAGCAGAGTCAACGTAATTGTAGTTGGGGTCGTAAGAAATAAACTGCATCACAAGCTTTA
GAATAGCCTCCATATGCGGCGTAATATCATTGTGGCATCGAATCACAAACGCTTCAAATGCCTGAAAGCAGTTTCCACGAAGCTCATCCGAGTCTTCGTT
TTGCAACGATTCGTCCTCGGGATCTCCACAGAAGTGTACCAAAATACGGATTACAGCGTCTAAGTGTTGTCCAAGACGGTGGCCTGCAGTGCGCGAAAGC
ATTCCAATCGTCTGGATTAACGTGCGCACGTTGGCTGAGTCGGTAGATCCCTGAATCCCCTTGATCAGGTGCTCCACCAGGCGGCTCACCAGCACATCGG
ATGCCATGACACCCAGTGATCCCACACAAGCAGTGGCGCGCTTGCGCACAAGTGGCGACTCGTCCGTCAGTTGCACCATCAACAACTCCATGATCGTCGC
GTGTTCCGTGGCGACGTCGTAACCAAAACGTCGCAAAAGATCCGTGAGAATGTCGAGCGTCTCAGCCTTCACAGCTGCGTCCTTGTCCTTGCCTAGACCC
GTGAGTAGTCGTGTGCAGATTCCAGTGGCAATAGACGACCCAGTAGTCTGGGACACATCTGCCACAATCGTCTTCAGCCCAATCGAGTAGATGTCCCGGA
GCTCTGGTTTGCCGTTGAGGATGAGGTCGCAGAGCTTGGCACAGATGTCCGCCACCTGAGCCACTTGCACCTTCGTGACCAGAATGCCCAGACACTTGAC
AGCAATGGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTCAGCACCGCCGCACATACTCTTCAAAGCCCAAAACACCATATGAGTCGATCTCCGTCA
GACAGATAACTTCTAGCTAACAATACGTACTTTGGCTCGAAGTACTGCCCCAGATCGACGTCCTTGTTGAGCTCAACACACAGATCCGACGTGGCCATGT
AGCGCTCATCCTTGTCGTAGTCTGTGGTCTGCACACATATAGAGGTCAGCAGAAGCACTCATCTCGGAGGCATTCGCCTACCTTGTCCAGCAGCCGTACG
ATCTTGTCCTCGTTCGCGCGCATCTTCCCTTCTCCAAAAGTAAAAGAAAATGACGCGGAAGATCTTGGGTAGATTATGTGCACTACACCAAATTGATCAT
CACTCTCGGAAGTTTTACTTCAACAACCAGTCCACAATTGGAGCCATGAGTAAGGAGCTGCTTGTCGCCGTCTTCATGGCCATATACTTATCTCTGTGTT
TGCAGGCGACAGCGACGCAGCCGTGGCACGTGACCAGCTGACCTCTCTCATCTCGGATGAGGTGGAGCGCCAACTGCGAGAGCGAGGGTCCGCGCTCGAA
GCCATGAAGGAGCAGATGGCCAAAGTGCTGGCTGAGTTCGAGGACATGGCGGCCAACATCAACTCCAAGCGCTCGTGGTCCAACAGTGTCGTCAAAGCAG
CAAAGCCGTTCATGTCGCCCAAGAAGATGACATTTGACATCCACCCCGCCGTCAGGACCTTGGATATCGTCCCTTCAGCGGCATCTTCTCCGCCCAAGCT
GCCAAAGTATCTTAAGATTTTGAGTTAGGTAGGTGGACATGTGTTTCTTATTAATGTTTGCATTCCTGGGCAGAATTGGCGGTGGACTTCTCAAAGGTAT
TCACCAGTTCAAGCCAAACGCTCTTCTGCCAGGACCACGCAGTCCTGATGGTAAAATTACTTTTGGTAAGGGTATATTATCTACTTTCAAATCACTGCAC
TGTTTCCCTCTGACCTACGATTTTGTTATCGCTCAGACAAAGTACTTCCGCGAGTTGCAAATATGGAAAAGCGCACTGACGGACTACAGGTGATGTTGTC
GGAACAACGGCAACAAATGTACGAGCGAGCCTTGGTGCGATACCCGCAGTGTCGAAGTAATATATTCGCTCCGAGCGTGTATGAGTGTGAAGATTCTATC
TCGGATACCAATGCTTCGCTTCAGACACCCCGTGCATCGTTAGAGCTTGAATTTGTCTATGGGTGCCGTGGTGGTGCTACAACATCGTTTTCCAGTAGTC
ATCCTGCAGCACCCAATGCAAGTACTAATAACAGCGCATTCTATTTATCAACGGGGGAGGTCATGTGGTTCACTGCAACATTGGTGGTTTTGTACAAGAA
AGAAACCAACATACAGAGGTACTTCCGAGAACACACAAATGAAGTTACGAGCTTGACGGTTCATCCAAACCAGAGAATCGTAGCATCAGGACAAGCTGGA
AGATCTGCATTTCTTCTGGTATGGAACGCGAATGATGAACCACTGGGCAAACGGTTTGCATGCCTCACGGGCCATCAAATTGCAGTGAGGTCTATTAGCT
TTTCTCACGATGGCAAACTGATTGCTTCTTTGGGTGGAGATATGTACAACACTATCTGCATTCACGACTGGAAAGCCCAGGAACTGTTGGTTAGTGCTCG
CGGTCACACATTTCGAGTTCATGCAGTTGCATTCAACCCATTTCAGGCGTATGGTCGACCTGAAACTCATCGATCTAAGAAGCCAGGACAAGCTTTACAT
GATGATGATGCTTGCTACACGTTGGTCAGTTGTGGTGTCCGGCATATCCGCTTTTGGACCCTCACAAAAGCTGATTACGTGCCTCCTCCTTCAAAAGAGA
ATGCCGATAGCGCCTTTCATAATTCCACGTTTGGTGGTCCTCCGAGAGTACGTCCTCCAACGCCAACAGAAAAAGTTTGGAAACTGGAGGGCAATGTTCC
GTCATTTCATGGACGCTTTGAAGTCCAAGATTTTACAAGTTTGACGTTTGTGAACGATTCTCCACCTCTCTACATGTATGATGAAGACTCAAAGGAATTG
GTTGCGACAAATGCCACAGATCATTCACTTGGTCGGATCATTGCTGGTACAGCTAAAGGTGATTTATGTCTGTTCTTGCAGCTAAGAGCGAGTCCTATTG
TTAGTATTGTTTCCGAGAGTGATGTACGAAAAGAACCTGCTAAATGGTGGGAGATTCCAGACGAGTACACGGATGCCGAAATTAATGAGCTTGTGTTGGA
GAAAATCGTGTACGAACCGACTGGAAGACTTGTTGATGTCGTGCCCCATGATCAAGAAACTGGTAATCGATTTAAGCTTCCAAAGCAAACCCAAGTGGAT
ATGGAAGGACTGGCAAAAATAATGGCAATACGGCCTAACTCGACTGTCTTCCATTCCCGAATGGGTGAAATAAATTATAATGGCCCATTAGCACATCATG
GGGCAGTTTATCAAGTGGCGTATTCTAAAAAGCTCAATATGATCTTGTCATGCGCAAAAGATGGAAAACTTTTGCTGTGGAAATGCCACATGAGCAAGCC
CATGCGTATACCTGGAGTTAGTACGTACGGAGTGTTCACACCAGTCACAGGCACATTTTCAGAAGGTTCACACGCATTAATGCCACTTGAAGACCCAGCA
AAAGTTTTTCAGTTACCTCCTATATTGCCAAACGAATTTACAGCAGGTGGTGCGGCTACTACTCCGAAGCCGACTAGCATTGTGTGGAAAGATGACGGCA
AGAGTGTGCTTGTTGCCACTAGCAACAACTGCATTTGGGAACTTGATATCACGTACGGTAAATGGCAATTGCTCTTTGAAGCTTGTAGTGGTGCTGTAGC
CACATGTGCAGCACACCCGTCAATGGAGGAAGTGGTGACAGTGTCACACGATGGATACCTAAGCTTTTGGGATCTTCAGCAACATATTTGTAAGCACCGT
CTCTACCTTGGTGTCTTTATTATCTCTAGTGTCAAAGCTTCTTGTATAGAGTTCCATCCTGCAGGACACGAGCTCGCAATTGGACTCAGCTCGGGTGAAT
TGTTGATTGTGGACTGTGACGAGCTCAGAGTATCTCTACGGAAGAGCATCAAGTCAAACTTCAGCAGTACTGCAAACTTGCATTTGGGTCTATCTGGTCC
CGGATTTCGAGCGATTGCACAGGTGAAATACTGCCCAAATGCAAAATATCTAGCAGTAGGGGTGAAGGACACATTTGTTTACATCTACGATGTCGTCAAC
GGCTACAAGAAGCTTCATGTTTGCGAAGGTCACTCAAGTGCTGTGATGCATTTAACGTGGAGTAAGGATAGTGACATCTTGCAAAGCAATGCTGCGGATG
GCGAGATTCTTCATTGGTTATTATCTCCCACAAAGGGTGACACCAAGCAGATTACTGACGCTTTCCTAGTCCGAGATGTGCAATGGATGAAATGGACATG
CGTGTTTGGATGGCCTACGCCTGGGATCTGGTCTGAGGATTCACCCAACCTTGTAGATATTGCTGCCATCTGTGCTACGAGACCAAAGACGATTCCTAAG
AATGAGGAAACAGAAAATTCGCACTTCACTTCGAACGAAGACTTACTGGCTGTAGCTTGTCGATCAAATCTCCATCTCCTCAAGTATCCTGCTTTTCGTG
GTGCCAAGAGGAAAATTTACAAGGTCCATTCATCATCTATTGCAGCGATGGACTTTTCGTTCGACGATGCATATTTGGTCACAGCCGGTGGCGACGACAG
AACACTCATGCAGTGGAAAGTTGTATCGGGATATGACTCTACTCATGTCAGTACGAAAGCCATCATGAAAAATAGGCCTCAAAACGTTGAATGCGATATC
ATCGGGGACCAGAGGCCAGACTCGAGTCCGGTGCCTCCTCCACAAAATGACAAGAAACGATCAAGTCAGCTCTCACCGCGACGGCAGTCTCGCCAATATC
GCGAACGCCCTGTTCATCAGGGCAACGACAGCTCTAACGACACACATAGCGAACAAAGGGATGATGAAAAGAAAGAAGCAGATGCAGCCCATGAAGATTC
GCACCGAAGTCTAAATGAAGGAGGCTCAGCAGGTCTCACAGATGGTGAACGTCAAGCAGGAGAGGTAGGTGCCAGTCATCGAGAAGCCTCAGATCAAGAC
GACTTCCTAGTAGTACCTGTTCAAATGAGAGCCACACACGATTACACTAGTGAAAAGTCTGACGAGCTCAGTCTTCATCGTGGTGAAATTGTCCGCGTGG
TCTCCAAGTCAGGTGGTGAGTGGTGGCTCGGAGAAGCGTGTGATGGTACCAAGGGCTATTTCCCTGCTAGTTTTGTAGAAGATGTAGACCTCAATGTCCC
CGTTTCAGGAGACATGGCCATAGCCAACGAAGAACTGATAGCAGAAAGTTGAACATTGATGCACATTTTAGTACTTGAAGTTGTCTGCGACGTGTGACGA
GATGGCTACAGTTTCGGTGGCTCTAGACAACCACAATCAAGAGTCGAGATGGCCGATATGTTCATCGCCAGCTCGACGACATTCAGCGATCTCCCACTCC
ATGGCGATGTGGGGCGCGCACTGATAGCTATGTGCTTTGTGCGCCCGTCGCCCATCCAGTTGCATGCGCTGCCCGTAGCTCTGTTCGGCAATGATGTCAT
TGGTCAGGCCAAGTCTGGAACGGGCAAGACTGCAGTCTTCGGAGTCACAGCCATTGAGCACTCGATTCGCTACGTAGAACAGCGAAAGCAGCAGAGAGAG
GATCAGGTGGTGGGAGACCCATTGGCGTTGATTTTGGCACCTACACGAGAGATCGCGGTGCAAATTGAGACTGTGCTGCGTCAACTGGCGCAATTCCGAC
CGGAAATCGTCATCCGCACGTGCATCGGTGGGCTACCAGTGGCCCAAGATCAGGTAATGGAAAGATAAGTATGATGCAGTATGAAAGATACTTTTTAACT
GTAGTGGTTATTAGATGCACTTGGCAGCGGGGTGTCATATTGTGGTAGGCACCCCTGGACGTGTGAAGGCACTCGTGGATCAGTGTTCACTACCGTGTAG
TGCCATTCGGCTGCTCGTGTTGGATGAAGTAGACAAGCTCATGGCGAGAGATTTCGAGAAAGATGTAAGCGTGGTGAAGTTGTATCACAATGAGCTGATC
TGCTAAGTGTGTTCACTTGCAAATGGAATAGATCCAGTATATTGCAGACTCTCTCCCTGAAAGGCGACAGGTGATGAATTACTTTGAAGTACTTTTGATG
AAGACACAGTGACGCCTTTACTAATTGCTTGTCCATTTATTCGCTGCTGGAGATAGACACTCGCATTTTCAGCCACGTTCACATCTGAACAGTTAATTGC
TGTGACCCAGTTAATGAGGACTCCACAGGTTTTGTCCTTACACGCAATCGTAATAGGTGTTAGGAATGACTAACTAGTTCATTTCTGTTGGGTAGATCGT
ACGAGTTCGTGGTCCCGATGATGTTACAACCGAGTTCATCTCGTCTGCAGAAGACCTCGAAAACTGGAAGAAACGAGAGCAGTCAAATGCTCCAGAACTT
TGGCTTCGTCATGTGAGGCAGTTTTATAGCATTGTCAGTTCACCATCTACACTAACAGGCGACGATATTCTGAGTATGAAAGCTAAAGTGGTGAAGCTGG
CAGCACTGCTTTCGGAAATCGTGTTCGTAAAGTGCATGGTGTTTTGCAACGATAAATTTCGCGCTGAGGCACTGGCCACAGCTCTTACAGGGCAGGGATG
GCCAGCGGCATGTATCACTGGCTCACAGACTCAAGCTACACGCTTGGAAGTCATGGAAGGCTTTCGTACGTCTCGTTCACGTGTGCTAGTGTCGACTGAT
CTCACTGCGCGAGGTATTGATGTCGACAAAGTCAACTTTGTGGTACGTGAGTTGCATTCATTTGAAAGCAATGGCTTCTGATCGCCGTACTGTGAATATG
CAGGTGAATCTCGATTTGCCACGTGACCCAGCAACATACTTGCATCGTGTCGGGAGAACTGGTCGTTTCGGGTTAAAAGGTTTGGCTGTGACATTGTTAT
CAGCAAAAGAAGTTCAAGGTGTTCATCTTCTTGCGCACGTTTTTAAGATGAATATTGACGAATTACCCAGCCCAGTACCTCCAGAGATCTATACCTACGT
AGCTGCGGAGGAAAACGGCGTCGATGACGAAGCAGAGAAGGCTACTGAGTGTGAGCAAGTATCCGGCGCAGCGAGTGAGGTTGTAAATGAACCGAGCAAA
TACAAAGACGACACCGTCTCAACTCCACAGATGGACATCAACCCGACTCCGAATCTGAGCATTGGGCAAAACTTGTTTTCAGCGAATACCTCAAGCCAAT
ATGACATGGAAGAGAAATCGTATGAAGCCTGGGTGAAGTTGCTTTAGATGCATGATGGCATTATCCTTAACGCTGCCGATATCCGATGGAATCAATAGAA
GTTTTGGCATTACCACGCGCAAACTCTTCGTTATTTCTACCTGGTCATGTCTGTGATGATAGTACGCTTGGCTGAGGTGAACGAAGCAATGTGTGAGGTT
GCGACTCACAGCTGTGGAGCTAGCCGAATTTCTTTACGATACGGCGCAAGGTGTTCACAGTACGAACTGTAACCGGGACGCCCAACTTCTTGTCGAAAGC
CACTTTGAACAGCGGTGACTCGCTCATTTTGGTAGTTGAGTACCACACAAAAGCTTTGTCAAGCAGTTCGAGCTTGTCGGCGTCGGTGGAGAGTGCTTCG
ACGATATCTCGCTGCTGTCTGGTCAGTTCCTCTTTCACCAGAACCACATTCACAGCAGTGGCAGACTTCACAACCTGCTCACCAAGCTGCGCCACCTCGT
CCATGGATCGAGTGAACACTGGAATGTGGCATCCAAAAAGTTCCTCCAGTGTGTTCTCAACTCGCTGTTCGATGGAGAGCATCGAAGGTGTAGGCCCTCT
GGTGGTGCTCACAGGCGAGTCAAAGATGAGATTCCCGCTAGCTAGGAATGTCTCGACATTACGGAATCCTGCTTTGCTTAGTGCGCTGGCAATGGATTTC
ATGCTATGCACGCGGCCCCCAACGTTCACACCGCGGAGGAACGCCACGATCTTGTTGCTGCTACTGGAGCAGACATTGTCCGAGGACGACGAAGCTCCAT
CGGCTGCATGAATATCTTTAGAGGCCTTCAACTCGACAGCAGCAGAACTGCGAGCACTAGAACGTGTGATCCTCTTGGCTTCGGGCGAGTTGTCCAGCGT
CGAAGCTTTCCTCTTGGTTTTGGCAACCATCGTAACTGCGACTCGACGTATTGTGAAGATGAGAATGGCTACCTGGATTCGATCAATTTCTCTGCCGAGG
ACACTTGCTACAATGCACCGACAGTAGAGTAGCCATGTCCAGAGCGTCCGCATTCATCTACATCTGTCCATCTTGCATTACCTGTAATAATACATGTGCT
ATGTTTTATAAAATATTCTCTAAAATCTGCATATTTGTATGCGACTTCATATCACTCTCTCTATTCTTCCCTGTCGAATCCAATGCCTGCGTTTGTTCCG
CCCTGGAAGCTCGAATACACGACATAACCGACTCTCCTCGGTCCCGAAAGCTTCTCGGCTCGCTTCAAGCGGCTCTCTCTGCCGAGGCGTCGCCATCGCC
GCAGCTCCACATCCGATCTTAGCCGCTCCCTGTCACCTCCAATCGCCATGACCACGAGCAGCAAACCATCGTCCTCCGCGACTACGGCGTCGTCGTCCTC
CTCGGACAACAACAGCACTTTGCAGCAGTATATCTCAGCCAAGGAGGTAGCACAGCATCAAGTCTTCCGGAACCACGACATGCGGCGCTCCATCAGCTCC
ACACAGTTCAATGGCGGCCGCGAGAGCGCGTCTAGTCCTGTATCCAAAGATCCCAACAAGATGTCGGCTGCTGGGTCGTCCATGTCTGCTTCCAACAGCC
CTCGCTGCTCGTCACCTGCTTCGTCACCCATGGCCGAATCTATCCTCAAGGTGGTGCTTATCGGTGACTCCGGCGTGGGCAAGTCCAACCTTGTCATGCG
TTTTACCAAGAACAAGTACATGCCACACAGTGTGCAGACTGTGGGTTTCGAGTTTGCCACGAAAACCATTCGAGTTGGGGATCGAAGACTCAAGGCACAG
ATCTGGGACACTGCAGGACAAGAGCGATTCCAGTCGCTGACTGCAGCCTATTACCGCAACGCCGTGGGTGCTATGATCGTGTACGACATCACAAATCGCA
GCTCGTTCGAGCACGTTACCGGGTGGTTAGCACAGGTACATGAGCACTCCCATGAGAGTCTGGTACTGATTCTTGTGGGGAACAAATGCGACCTCGCTCA
CTTGCCGGAGAGTAGAGAGGTATCAACATTAGAAGCTGCGAGATTTGCAGCGAAGCATTCCATGGAGTTCCTCGAGACGTCGGCGCTGGATTCGACCAAC
GTCATGGACGCCTTCAAGAAGTTGATTGTACCGGTTGGACGCCTACTGTCGCCTACTGAGCCCAAGAAGATCGCGCGATTGCCCCCAGGTTGGCGACGTG
TTTTATCAAGGACCAGACCAGGGGAATATTCGTATGAGAACCAGTACACCAAGGAACGGATTTCATTTGCGCCAAAAGAACCAGCTAAGCCTTCTCAGCA
GAGCTTTCGAGCGCCTGCTAATGGTTCGAAGAGCGGATCCCCGAGTGTCGTTACCGTCACACGCGAGAGCCTCCAGAGACAGCATCAGAAGGCATATCTC
GCACAGAACCAAACGCCACAATGCGGCATGTGCATAAGTGACTGCACTATATTGTAAACATCGGTCAGATGCTGAACGGCTTGCCTCGTGGTCATCAGGC
TTCAGGCAACCCGTCCTCATTTTCGCCACCAAGCCAGCACAGTCGACTAGACCTGTGCATGCTGACGATACAATGAATCCAAGTCAACGAGTACGTGAAC
CCATCGCAAGAATGAAGATGGCGGGAACAGGGTCAAATAGAAGCAGTGGGCATTCATGTTTTTAGTATAAGGTCGTACTGCCCCAGTGACAGCGGATTTG
TTGTTGGTAAAAAAGCCACGTTCACATGTTCTGCTTCATCCAAGTAATTTATTCTTCTTCGCTCTAGCATGATTAAAGCCGGTCATGTTTTCTTCATGTT
GGTTTTCTCTATGTAGGTTCTCACCAGATAATGAACATGATGGATTGAACTAACGAAGTCGCACCACAATCATTGCGTGGCGATTTACTTCGAGCGCTTA
GCCACCAAGAATGCAACGGCAACGGCCGCAACGGCTAGCCCGATGGTAGCGAGCTTGCACTCAGTTGGAGCCGACGCCCACTGACAAAAGCAGTTGCTGC
TGGTCTTCTGATTCTTCTTAGCAATCGTCTTGCGAATGTGCTCGGCCACCGTTGCGCTCGAATTATTGGCCACAGATAGTCGGGTGGAGAGCGACTCCAG
CGATTTAAGAATCGGGTGTTGCTGGATTTCCGTCTCCGCCACGCCAAGCGCCTTGGACACCACAGGTAGGAACTTGCCATAGTGGGCAGTGCCAACGACA
ACAACTGCCGCGTTCGGCTTATTAGCCAGCTTTTCTTGACCGAAGTGCATGGCAGCAGCCGCCCCAATAGCGCTGTGCGGGTCGAAGAGGTACTGGTGAA
CCTTCTTGTACTCGGCAATAGTGGAGCACACCTCCTGCTGGAGCACCGCGTACGATGCCATCTCGTCCTGCGCCTTGGTGAGCAGCTCGCCCGAGATTGT
AAGCTCACCAGTTTGCTCAAAACCCTGCATCCATTCGCGCAGAATGTCGTGATTCTCGCCGCTCAGAGCAAAGAGGTAGCGCTCGAAATTGCTCGACACA
CAGATGTCCATGGACGGCGAGATCGTGTGCTCGATGCCGTGACGGTGATATTTGCCAGTGGAGAAGAAGCGGTGCAGAATGTCGTTCTCGTTGGTGGCCA
CGACCAGCTTGCCAATAGGCAAGCCCAACTTCTTGGCGTAGAAACCAGCAAGAATATCACCAAAGTTACCCGTGGGGACCGAGAAAGCCACCTCGCCACT
CACACCCTGTTCACGAGCACGGAAGTAGGCCCAGACATAATAGACGATTTGCGCCAGAATGCGGGCAAAGTTGATGGAGTTGACCGCACCCAAGTTGTAC
TTGGCCTTGAAATCAGCGTTGGCAAACAGGTCCTTGACAATAGCCTGACAGTCGTCGAACGTGCCTTTAACAGCCACGTTGTGGATGTTCTGGTCCAACA
CTGTCGTCATTTGGCGCTGCTGGATGGCGCTCACGCGTCCCTCAGGGAAGAGGATAAATACCTCAACATTCTCCTTTCCGCGCAGACCGTAGATGGCCGA
GCTGCCCGTGTCACCCGAGGTGGCGCCCACAACTGTGATCTGGTGCTTGGGAGCACCAGCCGGCAGCGCATTGTTCTTGCGCTGCAGGAAGAACTCGAAG
AGGTTGCCCAGGAATTGCAGTGCGATGTCCTTGAAGGCGAACGTGGGGCCGTGGAAGAGCTCGAGCACCAGCATCTGGTCCGTCACCTTGACGACGGGTG
CCACTTCCTCGGCTCGGAACGTGGTTGCGTTGTAGCTCTTGGTGACAAGCGAACACAGCTGGTCGCGCGAGATCTCGCTCTCGTCGATGAAAAGGCCCAT
GACCTCGACGGCCAGCTCCTGGTACGACAGCGATGCCCACTTGTCCAGTGCATCAGCGGGTAGCGTCGGGAACTCGTTGGCTTCGGGCACTAGAAGACCG
CGGTCGGACGCCAGACCAGTCAGTACAGCCTGCTCGAAGCTGAGGCCACGGACGCCGCCGCGTGTACTACGGTAGTGCACCATTGTGTGTGGGATGTCGG
GGGTGAGAGTGAGAGTGCGGAGTCGAAAGGTGCCTGCGCCAATGTGAGCCGCTCAAGAAACTTCTTGCAGTGGAGACGCGTCGAGGACGATACTGTTGGG
GCGACATTTAAACAACATTTTACGTTGCGCAAACGTTTCGTACATGTGACGTGGCGAAGTTTGTTGTCTAATCTGTGGTGCACACATAATGGTGTACAGA
ACATACTAAGTTGAAGCGAAGTTGTAGGAATTGGCCTGTATGCGGTAATCCACGCATCAGTCAACTTTATCTCTCTACACTCACCAGCCGTAGAAAACAT
GCCAACCATCTTCAATATGAGAAAGATACAACTCCATGACGAGATCAGTCGACTAAAAAAAGCAAACAGGGAAATATATTTCGCACAATACTATCTCCCT
GAAATGTTCCACAGACTGCTGCTGCTATCGTCCAATGGTTCATCTGAATCCGTCATCCATAACTGTCTACCTCATGATTCCGTGCTGAATCAGTTCTGGC
CAAACTGGAACATCGTCGGCTGGTCAGAGGATGTGCCAAACTGGAACTGCTGTGCGTTAGCATCCGTGTCAGGCGCTAGGCTATCCTCCGCATCCTCCTC
GCCATTGAAGTACGATTCCACAATCTTCAGGGACTTCATGTAAATGTCTGTCGTCAGAAACAATGCACAAGTTAGTAAGCACCTCCCTCACAAAGAATAA
CGGGAATCAGTTTGGAGCTCTAACGCACCTTCATTGGCATGGTATTGCAGCGCTTGGATCTTGTTCACACCGTCCGCTTCATCGATCATTGTGGCAACGT
CATTGATATCGCTAGTCTTCTTCGCATCGCCCGTACGCAAAATGTTCTCAAGACCTTCCAGAGCCACAATCACAACCTTCGCGTCCTTTACTTCCAATAG
ATCGCATAGCGGCTTGATGCAACCTGAAAATACCTTGATCTATTAGACACAGTAAAACAATAAGATGTCGCTGATCGTACCTAGGCTGACAAGGTGCATG
ATCTGATCAGCCGAGCCACCAGATGTGGCGTTCGACACAGCCCACGCGGCTTCCTTGCGGATGTCAAATTCCGCCGTTGATAGGAAGTTAATCAGAGAAG
GGAAAATATCAGCCTCGATGATGAACTGGATCTGCTCCTGGTTGCCGGCCGTGATGTTGGAAAGCGTCCAGCACGCCTCCTTTCGGATGCCCTTCTTTGG
GCTCTCCAGAAGCGCACGTAGGCATGGGAGTGCGTTCAGGTTGATAATAACCTGTGTCTGCAAATCGTCGCCCGTCACAATGTTCCCGACCGTGCGCAGA
GCAGGCGTCTGCACAGAAGGTGAATGGTGCATCAGCAGCTCCACAATTCGCCGGCAGACACCAGCTTCAATCACTGCCTGAATCTTCTCGTTCGAGCCAT
CCGACAGATATGACAGAGCCCAGCATGCGTCCGTCAGCACTTCCTCGTCGTGGGTGTAGATGAGCTGACCCAGAGTCGGGAGTGCGGGCGACACAAGATC
AAATTGCGGCTGCGGTTTACCACGGCAGAAGTTGGATAGTGTCCATGTAGCGTTACGCAGCATCGTTGGCTTGGAGTTCTCCGTCAGCTGCTGCATGAGT
GGGCGTAGAGCACCACAACGGAGAACCATGTCACGGCACTCAATGGAGTCACCGGCAATGTTACCAAGTGCCCATACGGCCTGCTCGCGCACATCGTCGT
TCGTGGAGAGCAGCAACTGGCAAAAAATAGGCACAGCACCGTAGTTGATCACCACCTCGGTATCGGCAGAGGTACCGGACGCAATGTTGGTCAGTGCCCA
GGCAGCTTCGAACTGCAGCGTGGGGAAATCCTCGCGTTGAAGGAACTGCACAAAGATGGGGACAACACCGGTCTCGATCACCTCCTTGATTGGCGGATTG
CGTTCTACATCACAGGAATCACAACCAAGTTAGTTTAATCATCACTTTCAGCAGTGGATCCAGATAATCACCAATAGACAGCAATTTGCGGAACTTGGTC
ACCGCCTCAAGCTGCACAGCCGCGTCGCTCGACTGCACACCCGTCACCATTTGCGGAAGCTCTGACAGCTGCAGCAACATCACAAAAAGTCAGCATGTGT
CCTCTATCTGCATATTTAGCGTCTGTTTACCCGCTGCAGCAGCGTCATCTCGCTGGCGGCATCTCCCATAGCAGGCGTCGCGGCAGCTCCGTTGTCCGCC
GGTGCCTACATCAACAATAGCAACTGTGAGATTCCCAGTCAACGTCAATTGGAAGATACGATGCGCCTCGAAGTTGCTGTCAGCGTTTCAAGGCACGAGT
CTGCTGTCTAGGTAAATCTTTTCCTTGTGATTCTATAGCTGCTATTGACTGCCGTACCATGCGGCGGCGCTGGTTCATGCGGTCCTCTTTAATGGTCTTG
CGGATCTGCACAGTAGTCTCCATGCGGCTGCGGCGCGACTCATCGGCGTCAATGCCCTTCTTGAACAAGTTCTTGCGCTCCGGCGCTTTACCAGCGGGGA
ACGACATGCTGCTAATCTGCTTTCTCGGAGCCTCGACGGGGCACGGATCGGGACGGAACTTGGAGCTGCGCGGCTTCTTTCCTTGTTTCCCCTCCGCGGT
ACTGGGCGCCAATAAAAAAGATATATGTGGTCCACGCATATCAAAGAAAACGGCTCCTTACAAATTGCAAGAGGTTTTATCGGTGAAGAGGAAAAACCTC
GTCGGACTTTCCAAGATATGAAATGACTGCTACGTTATTTGCCGTGATTCTGCTCTGCATATTGCTATCATTTCACTACACCACCGGAGAGTGTATGTTC
AAGCTGTAGCCATTTTGCCAAACGACGCGAGTGCGTGGCGTCGATGAAGCCGAAGGCCCCCAGTGCTGAGGTCACACCTGTGTCTTCGTCGCGGAACGTA
GTGATCCATGTGTTCGATGAATGCCGCAAGATCAGCAAGGAGTTCACATGCCAGCGGGACCTGCTGTTGGCCAAGATGAAATATTTTCAAGCGTATCTGA
ACGAAGCCAATGAGCACGACGAGATCGACATCTCAGTGCACTGCGATGTTGAAATCTTCGAGTTGCTCATGGAGTACATGCATCAGAACTGCCATGAGTG
GCGACCGCGCATGACACTCGAGAACATTGCATCCATCCTCGTGTCCTCCGAATTCCTGCAGATGGAGGAGCTCGTGGAGGAGTGTGTGGCTTTCATTTCT
GGACGCGTGCAAGATTTCATGATGTTACGAGTGGACTTCGGTTGCCTTTCGGACGCAACCGTCGCCAAGATTGCTAGCAACTGCACACCTGAACAACTGC
AAACACTGCACGATCCGAAGGACAAAATCCTGTCAAAGCTACGGCGGAAAAAAGTGGAGGCATTGGTGAAGAATCTGCAGGAAGGCGGGCGTCGATTCGA
GATGTGCACGAACTGCGAGTTGCTCTTTATTAGGGGTGAAAGAGAATCTGTAGGTTGTCAGAAGGGTAAACGTCAGATCGGTGTACATGGTGAGTTGGTT
GGAAGACATCAAGCAAAACCAGGATGGCAGATCGAAATGTTCCTGCGAGAGCTAGGTGCAAGCAAGGGCACTTCATGGAACGCGGTGTACTGGTACATCT
GGGGATCCACTAAGTTCTTTAACTGCAATGTTTGCAAGCAAAGATGCAGTCTGATAGAGCTGCGAGATTGCGCGTATCACCCCGGCTCCATCGTCGATTA
CGGTCCTGGAGCGAAGTATTCCTGTTGCAGTGCGCGGATTTTCAATGCCGATGAGATATCGATCCGCGGGTGCAAGACCACAACACACGTGCCGCTCAAT
GGCGACAGACACGAAGAAGTGAACGTCTTCAGTAACGTTACGGCACTTCCAAGCATGTGGGATCAAATTCACGCGTGCGAAAAGATGGCAAGAGCTCAAG
GATCTCCACCTGCTGGAGATGCAGGAGGCGGGGGGAGGGTCGACGTAGCCTCGCTGTTTCCTCGGTTGCAGCCGATGAAACCCGTTGCGAACGCCGTCGA
TCGCGAGGCATCGTCCAGGAAGCTAGGAGAAGGCAATTCGTTGGGCTATCGAAAGCAGTGCAAGGTGCTTCAGCAGCAGGAGAAGGATCGCATGCGTTGC
CAGGACATCGCGCGACAGCTGATACAGCAGCGGAAAAAGACCATTTGCTGATAACGCACTGTAACCTGTGTACCATACATAGATTGACTAGTGGTTGGCT
AACGGCGACAATGTGGAAGCGGCCGCTGCGCGACGTCGTGGTGCGATGTCATGTGGGCAACCTGCGCTTGTCTGGAGTAATGGCCCGCAATGCAGTGGAG
GAGATGTCGCGACGGTGGCGGTTACCATTAGCCTCGGAAGGAACGAAACTCTGGGGCGAATACATGGCTGGAACTGCCATGGTCAGTTCATTTTTCAAGG
GTGAGGAGCGCGTCAAACTGATGGTCAAGACGCCCAACATTCAAGAGCTCTATGTGGAGTCGATGGCTGTCGGAGAGGTGGGATCGAGTTCTTGTAGTAT
TGGTTTGGGAACGTGATCTCAATGGTTTGTATGTATCCTGAAGGTCAGAGGTAAAGCCGTGTATGTGGATCAGTCGCTTGCTGGGGCACCAGAACATGGG
GGACACATGCATGTGTCCAAAATTCTGTACGGGTCAGCAAAGCCGTACAACACATCCATCGAGGCATCTGGGGTGGCTGAGCTGGACTGGCAGAGGTTCT
TCGATGTATCAGAACAAGTCCCGACAATTGTGCGCATCGACAGCGCAGCAGATGAAGACCACACACGCAGCTGTGGTTTTATCGTTCAGAAAATGCCCCC
AACGGAAGCGCACGAGCGGCAGTATGAGCTTGAGGAGCTGGCGTTCGACAAGCTCCCATTCCTAGCCACTGAGATGAAGAAAAATTCGGATCTGCTCGAG
TATCTGAACGAGTTGATCCCGGGCGCTGATATCACGGACGAGAATTGTAAGCGAGTGCCTCTGGATTACTACTGTCGTTGTTCAAAGGACAACTACGCGC
AACGACTTAAGGATATGGGATCATCAGATCTGAAGCAGATTGCAGCAGACGTAGGGAGCGCTGGTGTGGACCTCACCTGCCATTTCTGTAATGATGCACA
CCACTTTTCTGCTGACGAGCTGGACGGACTGATTGCGTCACTGTTCAAAGCTCAAAAGTAAGCAAACAGGTAGTATATCAACACGGTCTTAGAGAGATGA
ATATGACGAGTCATCTGTCTATGCGTTGGTCTAGCCTTCTTGTCCGAACTCCTGCGTCCACTTCACAAAACGATTAAGTTCATCAGGAGCTACGGTCGCT
GTTGAATGCTCCAACACATGAGTAAAATCACTCTGCAGAAAACAAGGAGTCAGCGCGAGGAAATCGACAGCAAACCAAATACATGCAGATATTCCTACCA
TCGAGATCATCGGCGGTCGGAGCTTTTCATCAGAGAAGCCACGATCGGGTAAATCGTATAGTCGCATGCGTAGCGCTCCGCATCGTTTGCAGGGAGCCTT
GCAGTCTGAACACTTTGGACGGCATGAAGAGAGTTTCATGTGACAGTAGGCACACGGTGGATCATCTTCGCAGGGTGTCAAGAATGAACCATTCCGAACA
GGGTGTGCCTTATCATCACACTGAACAACAAGAAATGACATCAAGAAGAAAAATTAGTCCCTGAGTTAAAAAAAACTCGAATACTTATCAATAAATGACC
AACATCCTTACCGGAGCGAAAAATTGAGCTTGTTGACACTTTCGCAGGGGTTCCATTAGCGCATCTCGGACAAGTACCGAGATATCTGAGCCAGAGCAGC
TATAAAATCGGCAGGAACGATGTTAATTCGAGAAAGCAGCCCATCTGTTAAACAAATACGAATCACCGTACCCTTCCGTTTTCTCTGCGATCGCTGTGAA
GTTTACTTCGCTCAGTTCGTTTGGGGTATCACCAAGGTGGATCCCCAGCATCACCTTCCGTGCGTCTGCGTCGGGGAGAGGGATATATATACGTTTTTCG
AATCTGCAGGCAAAAATTAACGTTAGCAATCTGCAGCTACTTCTCTTTCAGTTCACAAAGCATCTACCGTCGACGCATTGCTGGATCCAGCTCCCATGGT
ACATTCGTAGCTCCGAGCACCAGAACGCCGTCATGGTTGTTACCCATGCCCTGCATCTGAACAAGGAACTCATTCTTGATGCGGCGAGTTGAATCGCTTT
CTCCTTCAGATCTACTCGAACATAGCGAGTCGATTTCATCTATGAAAATGATAGCAGGTTTTTTCTCACGAGCCATCTCGAAGAGGTTCTTGACCAGCCT
AAATTGTACAACATTTGTCAGTCAGTAAGATCTACTTCGTGCTGCATCGCAGTATAGATATCATACTTCTCGCTCTCGCCTTGCCACTTGGACACCAAGC
TAGAAGATGAAACGGAGAAGAAAGTGGCGTCTGCTTCCGTTGCAACTGCCTGGGCAAGGTAGGACTTTCCCGTACCTGGAGGCTATAGAGCATAAATCAA
GCACGTTGGCGCTAAGTACTCAAAGTCACTGCAAGCAAACACTCGAGCTCACCCCATATAGCAAAATGCCCTTCCAGGGACGTCGTTTCCCTGTGAAGAG
CTGCGGGAACCGCGCAGGCAAGATCACTGCCTCTTTCAGTGCCTCCTTCGCGGCATCCAGTCCAGCAACATCATCCCACCCCACATTAGGTTTCTCAGAC
ACGACCGCCGCTGCCCATCAGCATTCAAAAGCCCGTCAATTCAATGATACAACACACAAGTAGATTTCATAGCGACTTACAAGCCAGCGAGCCGCGTAGT
TTAGCCGTTTCTGTGTCAGTCTCATCGTCATCTTCCTTGTCACCCCTGTACACAGCATCGTTAGTATCAAAAGGAGACTACAGTCTCACTAGAATCGATG
TATACCCCTCTACAGCCGCTGCCACAGGCTTGGGTGCGTTCTCCTTCTCCAGCATTCCCCGCAGCTGCTCTGCGCGCGTCATGTAGCCCTCTACACGTTT
CATGATGATCTCCTTGGACGTCGGATTCTTCTCGTCTGAATGGCACAAACAGATCAGTTGACACCCAATCCAGCGTCACTGCCAACTTGAAACGCACATT
TGACGCCGACCATGAAATGTTCCAGTGCCTTCTTGTACAGGCGGAAAGCCTCTTGATAGTTCTTGCTGTTGTCCTCATTGATAGCCTGCGTCACGATATC
AATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCCTCCTCTTCGACTTTGATTTCCTGTGTATTAGAGACTGACTGTATGGAAAATCCATCGGGTCAA
GACACTATCTGATTGGTCGAAATTATGTCAAACGATGTTGAAGTCGCTTGAAATCCGATATGGGAGCGAGTTCGTCCAAGGGAGACGGCGGTATCCGCTG
GAAGCTGCGGGCGATGGTGCCTCGCTCGTGGACGGAGCTGGAGAAAATGCACTTGCGCTTCCAACAGGAGGCTCATCGCCGTCGAGCCGACCCCACGTTC
CAGTATTTCCTGCCGTTTCCCGTGTTCCAGGCCATTGTGGCGCCACTTTGTCCCGACAAGGATAAAGTGCAGCTATTGGCCATGTTCGAGGTGCTGGACC
TCAAACAGACGAGGAAACTGGCAGTCATGGACTTCTTTAGCGGGTTGGCGCTGCTCGTAGATGCTAAGAAACCCCAGAAAGTCGAGTGTAAGGTGTCATG
CAGCAGAAGTATTGAGACAGATAGAAATTAATGATTGTGATTCTAGTCGTGTTGTCTCTGTTAGATAATGGAGGACTCAAGACGCTTAATAAGTGTGAGC
TGGTGATGGTGGTATCGGCTGCGGCGAGGGGGTTGAAGATGTTTGCTCCTGGAGCAGATGTCCTGCAGGAGACCACGATGAAGCCATTGATTCGACGTAC
GGACCTACGACGCGTGGTTAAGTATCGATATGAATATATGAATGTGAGCTCATATAGCACGCCAACTGTGTTGCAGGGCTCTTTGGCCAAAATGACGAGG
TCTTGCGGCAAGATGTCGTTAATAAAGCTCTCGCAGACCCAGAGATACTGTTTTTCATGAGCGATCTAGAGGCGGTGAGTGCTTTAAATCTGTAAACATA
GTGACGATATGACTTCATTGAGGTTCTGCTTTTTGCATGTAACAGGGAGTAGCAACATCCGCCGATGAGTTGATACTGCAACAGGGCAAGCTCATGAAGC
ATATGGCTCACCTCGATTACCAGGCTGCACGAGTGACAATGTCAGGTATTGCTACTTTGACAATCACATGTGCTAATGCTATTCAATTCTGGTAATTTTG
AACTGTTGTCCATATTGTTTGCCTGTAGAGAGAGGAAAAACAATCACAACAGTCGACAACAAAGACTCTGATGGACAGCACAAATTAGCAGCCTCATCGG
CACCCACAGTCGAAAGTTTTGCTCGCAGACTTCAAAGCCTGGTGTGTCCCCCTCCTCCAAAGGGGTCTCATCAATCCATGCGTGTAGTATCTGCTGTTGA
AGTCAAAAAGTATGTTGATGCTCGAACGTTGCAGCGATTAGTCAAAGTGGTCTCGGATGGCAGTTTGCCACTCACTCGTACTGAGGTAGGTTTATATATT
TCAGTGTCTCAACGATAAAGCTCACCATTGCGTCGATTTTGTTTTGATCATTGGTAGGCTGCAGTGCTTGTCGAGGATATGGCAGTGGATCAGTTCGGTC
ATGCGCGATGTGGTGATATCTACCGTGTCATGAAGGAATGGGCGATAAATCGACGGCAAGAGAAATCAGAAGCTCTCTGGGAAATTGTGAGCAATTTTGT
CGTTCAGGGAGCTCGAAGTGTGGAAAATTTCATGAAAGACGTAGTAGTTGCTCTCGTCAAAAGAGCAAAGAAGACACTAGGGCGTACTGCCCGTCGAACA
TCTGTAGCTAACGACTTTCGTAGTACTGATGATGGCGAACTTCAGTGGAGCCTTAGCATCCAAGTTGGTGATGCAGGTTTATCAGTGCAGACGTCAGCAA
GATCTCATACTTCGAAACGCATCAGATCTGCTCTCGGAAGCAACATCAGGTTCCGACTTGGGCTCCACCCACCAAATAATGATGTCCGAGGCAAAACCAA
CAAATCGGACTATAGGAAGGAAGAACAGCTCGATTACGACACCGATAACACCCAGCCAGAGGATCAAGAATTGGAAACTATGCGTCTTATCGTGAATTTT
TTGTTGAATCCGGAAATCACAGGTAGGAGTCACAATCTTGATGCATTCTGGAATACTTAAAGTACACGTCTAACTTGCTCGTTGTTGAAACAGATGAGGA
AGGCATTGACTTAGCATCATCGGTTGAGAAAGCAGTACAACAAGACCAAGTGTGGTCATCATTTGAATCGCTGTGGACGAAATGCTCAGGTTCAAACAGA
AAGCAAACTAGAAGTCGAATTGCGCTATACTAATGCTCGAACTAATGTGCTATGTATCATTCTGTAGCTACCGTGCACTCAGCCGTTCGAAATGATGGAG
GCGTTCAGCCAGTCCTTGGTAACTACCTCCGCGTCTGTATTGACTTTCGCGAAGACTTTATTTCTAAGGTGGAGGTAAGTTGTGTCTTTAAACATTTCTC
CTAAAACCTTTTCTGATTCTAAATAGTTCTCGCGATACAGGAGTGCACTGGTATATCATTTGCTACTGGTATTCGTAGCCTTTTCGTGTTGGCTGAGTTG
AACCAGTCGTTGTCCGATATAGTGAAAGCTTCACAGGAGGTGGCAACGTTGCTGCAAAATCTCGGGAAAAGGCAAAATCGAGAATGTGCCATGAAAATGA
TTTTTGATGCCTTCGACGCCGACGACAGCGGTGAATGGAACCTACAAGAGTTCAATACCTTCCAGCAGGCGCTCGGAAAAGAAGCTCTGCTCGAAGAAAC
ACTAACTGATTTGTTTGATGGGTCCTCGGTAATATCCTTTGAAAAGTTCTTGACAATGTACGAGACCTATCCAACTGCTAGAGTGCTCGAAATGATCCGC
CACCTAGGAATTGGTAGGGAATATTTCCCCCCACAATGTTCTAGAGTTCACGCTGACACACTTTGCTGATGTAGGATCGCTTGGTGACATGGTGAAGGGC
TCTGTCTCAATAACATCGACACTAAACGAGCATTGCTTGAAGGATCTGGATGTATTATTGAGCCCACTGCGCTGGGTGGATACGAGTTGGAAAAAGTTGC
TAGTTTTCATCACGAGCACGAAGGATTTTAGCCTTGAGCTCCATTTCTCCAAGCTTACCGAGCTCGTGCAAAATTACTACGCTCATACTGACATGATTGA
CTTCATCAGCGACCCAGTAGTTGTGGCCTCGTGGGTAGAGCGATTCGAGGAATTTATTCAAGCTCCACATTCTGAGCACTCTAAGGATCGTCCGTGTCGT
AGCATATTTTGTTCACTGGAGCATGAAATTTCCAAGACAGAGCAGCAGTTAGAGTTTGATGATCAAAGCAAGAAGCTACCGCGGGGGACGTCTGCTCGGC
GCGCTGAAGCTATGGTTCCGTTTCTGGAAATGGCAAAACTCGTTAAAGCGCACGTTCGAGGACCTGAAATACTTGAAGTACACAGTAAAAGCATCCGCCT
TGTGTGCGAATTGGATAACTTCCTCTAGCCAACAGTGATAAAGACGGAGGTATTCGCGGGTGACGTTAAATTTGCAACCAGCATAATAATAGAGGGGCAC
TAACACTTCCAGGTCACATTCATGGCAACCAAGGGCGAGATGATCTAGAAGGTGGTGATACCAATAAGTGATGAATCGTGTACACACAACGGCACCACCT
TGTCAACGTGAGTTGTCGTTTTCGAGCGAAGAGTCCAAGGCAGCGTATGCCCAAGCACTCGAGGACCGACACAGTGGCATGTACCAAGATGCCGTTGATG
CTCTTGAAAGCATAATTGAGGTACGCTGTCGTGATCATAACTCTTTTCATCACAGTGATATCGTTTCTAAGCACTTGATGCCAGCGCGAAGGTGACTCGG
AGAAACTTTGGACTGACCTTGCAATCACACAATTTCAGCTATGGGAAGCCCACGTTAGAGCATTGCACATGCCGTCCACTTTCGACATTTCATCAGCAAC
ACTGTCGAAACGACCTCGAGGCTCAAGTTATAATACCAAGCCTTTACACACCGTTCTCCTCCAAGAGGCTTACAGCACTTTTCTCATTGCGATGGAGTAT
CCAAACAGCAAATCGAGTCCAGACCTGCTCCTTCCGTTGGCTAGACTTTACATCGAATATGGATCATACCGAGGCGCTCTTTCAGTCTGTACGTTGTTGG
TGGAAGGCTACCCAACATCGTCGAGGCTCAACGAGGCCATCTTTTTGTCGGCGCTTACAGCATCAGCACTTGATCGCCATCGTGAGAGTGCACAATACTT
TCAGTATCTAGCTGAGGGGCAGGGGTCATCATCATCATTCCCATACCGCCTTGCAGCCTACCAGTTTAGTCTACTCGCAGCGTTAGAGCTCTCACGTGTT
CCAGGTATGCGTGCACTAGAGCGCGAGATGTACACCCAAGCGTACAAAGCTCTGGTTGGACTTCCACCAGTGTTACCATCAGAAAAAACTGCGCACACTT
TGTTCACGACATCGCGGAAGAACGAGGAACAGCGCACGTTATTATGGTGTCGTGATGTACAGACATGGATGGATCTCGCTCAGCGACTTGCAGGTCCTGC
TAACGCGCCGCTATTAGTTCTTTCAGCTCTTCGTGAAGCTCGCCGCAGGATGAAACCAGCATCAGGAGGATTACCAAGCGCTAAACTCCTTCTAGAAGGT
GCCAGCCTTCTGCGCACGGGAGATAATGTGGGGGCAGAGAGGGTTTTTGCGGAAGCACTTTTGAAGCTGCCTCGTGATGTATACTACAGCACACGTCATG
AACGATTCTTGCTGGAGATGTGCAGTGCTTCATGGCGGGACCGCTTTGCTTTGGAACACAGGAGTGCAGCACGTTTGCAAACGATGTTTCGGAGACGTAC
GAGGTTAGCTAACTGGCGTCTTGGCGTCGCATATGTTCTAGAACAACTGCGCCATGCAATGGCAACTCGAATTCAATGCGCCTGGAGAGGGTTCAAAGCA
CGCCAAGAGCTAGCATTCTTGCGCGAAATACAACGAGAGAAAGAATACCTGGCTAATATATCCATGGGAAAACACGATGACCGCTTGATCGAGCTCCAGT
TGAATGCCGCTGCAAGGAAAATTCAAGCGCTACTTCCCATCGCAAGAGACAAACGGACACTACGAGCTCTCCGAGCTAGAAAAACTGAACGCGAGGCCCT
GCTGGCGAAGTTTGCAGGCCGGCGTACCGAGCTTGGCCAACTTGGAGTGTTTCGAAGATGGGAGCGTTTTGCTTCAACTCAAAAGAAAGAGCGTGTCGAT
GCTGTTGTACTCATTCAGCGGCAATTCCGAGCATGGCGCAGCCGCAAACCTTGCTTCCAGTTGTTGCTGTTACGTCGACAGCAAAATGGTATCCTGCAAC
AATGTCTTGCCCGACGTTCAGCATCCATGATATCAAAAACGTTTCAAGCCTGGCATATGGTACTGGTTGGCGCTAGAAGCGAACGAGATTGGGCTTCGCG
GCGCATTCAACATAGATACCGCTCAAGGTTAGCAGTGCGTCAGTACCATGCAGAGCTACGACGCCACCGGGCTGCAACTGCCACGATGAACCGATTGCTC
TCAGATCGGAGGCGACAAACCCTATTAAATTCTTGGCGGGCACTTGCAAACCACGCCCTCGTCCGTTGTCTGCGTAAGAAGGGTGCAGCTGTGACTATCC
AAAAACATGTGCGGGGTGTTCTTGCTCGACGACAAGCTAAACAGCTTCGTGCGCGTCGTCGACGAACGCTCAAAATTCTCACAAAACTTACACGTTCGCG
GGAATCTCAACTACTGCAAATGGGGTTTGATCTGCTTCACGAGCATGTTCAAGCATACCACAGAAGACGATACGCCGCTGTGATTCGCCTCCAAGGTCTC
TTCAGAGGTTTTCGCACTCGTCAAAGACTTCATCGACGACTTACAGCCGTAATGTTGGTCAATGGGACGGTATCATTTGGCTCCGGACTGAAGGGATACC
CTCCAGACATCAAGCTGTGGGCATGTCTGTTAGCACTATCACGGTATATTTCTCAACGTGGCGCTGCAGTAATCCAAGTACAACAATGGTTGAGACAACG
TCAAAAGCGCTTTCTCACTTTTCGAGTACTTAGTAAACGTGCAGCGCAGCGACGTCTTCTTGGCAAACTGCAGCAGAATTTCTACACCGTTGCACGAAGC
TTTTTCCGAGAACTCCGTGCTGAATGCAATGCTAAAACAGCGCAGCAGCACGCGGCAGCAACCAAAATTCAACGTCAACTCCGATGCTGGCTGATGCACC
GACGATACCTGAGCACTCTCGATAGACACTCGGTCGCCGCCCAACGCGGCGAAAAAGCAGCGAGGAAATTAGTGTTTCAAAGAGTACGTCGGTTGTTCTA
TGGTTGGCGAGAAACAACACGGGTGACGCGACGAGAGCAGCAAGCGGCAGCTTGTCTGGTACAACGGACATTTCGTCGTCATCGGGCGCAGCGGCAAGCA
CGTTGTATCATGGCGAAAAAGGCAGCACAGGCAAGGCTGTTGTCCACAGCGTCACAAAAACCGCTGGAACGCTGCTTCCGTCAATGGGAGGCCGCAGCCC
TGCTCGAAAAGAGCGTGCTTCGTGTGCGTAGTTCATCGTTGATCGGGTCAAGAGAAACCACTCCCATCAGCGGTCAGCGAAAACCTGGCACAGCTTATGG
AGGCAAGTTCGATAAGCCACTCACGCTCGAGGAGGTAACTTAAGCATGCATCCTATTCTTGAGTAGGACATGGCACTAACCCCACTTGTACGCAGCGTGC
CGAGATACCATCCATACTTTTCTTCACGATGCTCAATCGTGTACGTCAAACCGGAATATGCCAGCTCTCGTATAGGTGCGTGCGTTATAACAATATGACC
CACGTTACCATGGTACCCTTCCAGCCACTCACCTCCTGTCTTCATCCAGCGGTGGTACAGTGTTTAAGGGGCTCCAACTCCGTCAACTTATTTCTCTATC
TACCAGCGTAATTGTCGATGGTGGTGGTGGACTCTCCACCACGACATCAAGCATTTTTTTTCTCAATCTCAACGAGCAAGTCGTGGAATCCCTTGATGTG
TGTTCCAGCTCCAGCTCGTGCCCAGTGCAGTCTCTCATCCTATACAATGCGCCGCTCCGACCTTCGCACGCGTCTCTTCTAGCTACCGTCTTGCAGCGCA
GCCGTCACAGTTCGAACCTTGCGCTCGTGTCTGTTGTGTTGGCCAACGTCCCGCTCGCTCCAGCCTCTGTCGTGTGCCTTGCTTGTGCGTTGGCCCAGAG
TCCGACTTGTCTACAGCAGTTGGTGCTCGAGCGTTGCCAAGTGGGAAGCGCCGGTGCCGCTGCATTGTTCGAGGCGCTGACTTCTAACCGAGCATTATGG
AAGCTCGACCTCAGTGGGAACCACATCGCAGACGCTGCGTGTCCGTCTTTAGCGCGAGCTCTGCTGGGTGGCAGCCAATTGCGCGTGTTGACACTGAGTC
GCAACTTCCTATCGGACCGTGGCGTGCTGGGCTATCTAGCTCCATCACTAGCTACCAGTCAATTGGAGACGCTCGTGCTGTTGCAGAACCCTCACATATC
ATCGCTGGGCATCGCTGCGCTCCAAGCAGCAGCATCAAGTCCGTTCTCAGCTCTATTAGGGTTGCGTGTCGTGTCCGACTAAGCGCTGTGATTGGTGGAT
AAGATGGCTACATGTAGCCGTTGGCTGCGAGGGTTTGTGTCGCTTTGGTGGTTGAAAGCGCTTGTCAGAACTCAACACGCCGACGACTTCCGACCCGTTC
AACATGGCCGACGCTTCCCCCGTGACTAACCGCAAGCAGGTGGCCATCCTGGATTTCGGCTCGCAGTACAGCCACCTCATTGCGCGCCGTGTGCGTGAGT
TGCACGTGTTCTGCGAGCTCTACTCGTGTCTCGTGAGCGCTGATGAGTTGCGCCAACACCAGCTCACGGGTATTATCCTGTCGGGCGGTCCGCAGTCCGT
CTTCGATGAAGGCGCACCCCACGTGCACCCGGAGGTGTGGAAACTCATTGAAGAGCAGAAGCTGCCTGTGCTCGGCATCTGCTACGGTCTGCAGGAGCTG
GCCTTCACCAACAATGGCAAGGTGGCCCCATCGCAGCACCGCGAGTACGGCAAGGCCATTGTGACCCGCAAGAACGGCGTTGACTGTGGCGGTCTATTCG
AGGGTCTGCCGGAGGAGTTCCAGATGTGGATGAGCCACGGTGACAAGCTGCACCAGAACCCCGACGGATTCGTGGACATTGCAACGACTGAAAACTCGGA
GCACGCTGCCATCGTCAACGTGGCACGCAAGTTCTACGGCATCCAGTTCCACCCCGAGGTCACCCACAGCCCCCGTGGCAAGGACATCCTGCGCAACTTC
GTGGTCAACATCTGTAACTCGCCAACCGACTGGGACATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACAGTCGGCCCCGAGGGACATG
TCATTGGTGCCGTCAGTGGTGGTGTCGACTCGTCGGTTGCTGCTGTCCTGCTGCAGCGCGCTCTGGGCGACCGCTTCCACGCTGTGCTCATTGATAACGG
TCTTTTGCGCAAGGATGAGGCCGTTGAGGTTGTTGACCGTCTGCAGACCAAGCTGGGCATTAACCTTAAGTGCATTGACGCTTCGGACCGCTTCTTGGTC
GCTCTGAAGGGTGTGACCGAGCCCGAAACCAAGCGGAAGACGATCGGCAACCTGTTCATTGACCTCTTCCAGGAGGAGGCCGAGCGCATTGGACACCCCG
TCGACTTCCTTCTACAGGGTACGCTATACCCTGATGTGATTGAGAGTATCTCGTACAAGGGTCCCTCCGCCACGATCAAGACCCACCACAACGTCGGTGG
CCTTCCGGAGAAGATGCACCTGAAGCTCATTGAGCCTCTGCGTGAACTGTTCAAGGACGAAGTCCGTGAGCTCGGTATGGCTCTTGGCATTGACGAACCC
AGTGTGTGGCGCCATCCGTTCCCTGGTCCCGGCCTTGCCATCCGTGTGCTTGGCGAGATCACTCCCGAGGCGCTGGAGACGCTGCGTCACGCCGACTCGA
TTTTCATTGAGGAACTGCGCAACAGCGGCCACTACAAGACCACAGGCCAAGCTTTCTGTGTCCTGCTACCAGTTAAGTCTGTGGGCGTCATGGGTGACGG
CCGCACATACGAGAAGGTCGTTGCCATCCGTGCCGTGAGCACGTCGGACTACATGACGGCTGATTGGTACCACATGCCGTATGAGGTGCTCGGCCGCATG
TCCAACCGTATCATCAACGAGGTGCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCGAACAGTT
GGGAGTCCTTGCTTTGCCACCACCTTTGCAGCATACCATCAGGCTACTAGGATAAGCTCGGCGGAGGACATTTTACAGTAACGTCAAGCTAATAGAGCAA
CGATACATGCATGTACACTAAGACACATCGAATGAAGCAAAAACGGGAGGCAGGCTGCCCATTCATTTTCATTTACCGTTTGATATTCAATAGCGATGCC
AATCGATGCAACTAGTTTAGTTTCAACTTGACCAGTAACCGCTCAAACCAGGGACTCAGCAGCATTGCAAAATGCGCGATATCAATGCATACGAAACACT
GACTGTGCTTGGTAGTGGACAGTTCGGTAATGTGATGCTGGTACGGCGGAACGCAGATCGAAAACTCTTCGCAGCAAAAGTTCCTCACCGAGAAGATGCT
ACTGCATGCCAGGCTGCTCGTCAAGAAGCTCAGCTACTCATGGATTTACATCACGTGAACATTATACAATTCGTCGCACTCGTTGAAGATGACAAGCAGT
TGGCACTTGTGATGGAGTACGCTAGCGGTGGAGACTTGGATGCGTTTTTACGGTGGCACCAGGAGAGCACGTAAGCAAACCAGTACAGCATATTGGTTTA
ATCATATTCTCCTCATGAACTCGTTGCTATGCGTAGGGGAGACCTAAGTGAGGCTGCAATCATGCGCATTTTCATTCAAATTGTTTTAGCCCTCCAATAT
TTGCACAGACATCGAGTCTTACACCGGTATGTCAACACATCTACTTTCTAAACAACCTGATCTCCTCACTTTTGTCTGTTTGGCGATTTTGTAGCGACCT
CAAACCGAAGGTAGACGTTTTTTTGGTATCATTATGATTACTTCAAGTTGTATTCCGACTTGCTATTCATTGCAGAATATCCTCTTGGACGGTGACGGAA
TCGTAAAATTGAGTGACTTTGGCGTCTCGAAGATTCTCAAGAGCTCTTCGGACTGTGCCCAAACCGTCACCGGGACCCCACACTACATGCAAGTTCGATC
CTCATCGCGCTCCTGTTAATAATTTAATTGTGGTTCACAACTCGTATTTACTGTTAGGGCCCCTGAACTATTGGAAGGAAGTACCTACGACAGTAAAAGT
GATGTCTGGAGCCTCGGTTGTGTGTTGTACGAGCTCGCCACTTTTTCTCCACCATTCAGTGGCTCGGCACTCGGTGCTGTGGTGGGTAAAATTTTGCACT
GCGAGCCGCCACCTATTTCTCAACAGTATTCTGCGGAGTTTCGAGCTCTTGTATGCAATCTACTCGAGAAGGATCCTAGCGTACGTGGTCAATGCACGAC
TTCGAATATAGTGTTTTCTAATGCTTGCAACGTGTGAATGCAATCAGAGACGACCAGACCTATCCAGTATTTTGAAGAGCGGAGCTGTTCAGCACCACAT
GATGCAATTGATCAGCGTCGCAACATCACACCAGCCATTGCTTCTTGAGCAGTTTTCTGCAAGAAGCATTAATCATGGAATTATCACCTCCTCGGAGCTC
GTGTCGCCACTTCCAACTGTCAACACTAACCACATCGACCATAAGCGATGTGATCAGGTAACAGTGAACGATCCAGACGCGATTTCTCCAAAATCAACGC
AACCAGAGGCTCGTCAACTTTTCTTCGAGAACCAGGTGCGATGAACTTGATTGGGGTTATGAGCTGAAATGTAACACTTGTCATACCTACAGGCAGCAGC
CCGGAGAAACAAAGAGCGCATTGACCAAGAAAGGTCATGTGCAGCAGTATTTCTTGACTGCGGTGATGCTAACTCTGTCGATCAGCGCTCTCAAAGGGCT
TCTGAACATGTTAAATGTTCCGCCCCACCTGCACCGTCCAGACTTCGAGCGCAGTCGTCACTGTACGTCACGAAAGGTACCAAATACAAAACATAGTGTC
TAACCAATGTATATTTTCCAGGTCAAACTACGAAGAGCTCTTGGATGCAGAGCGACGACGCGTTCAGCTCGAGACGAAGGCGCTTCAGGAGCGAATGCGA
GCGATGCAGACTTCAGATCAGCACCTTCAACTTGTCGACCCTCGTCTGAGTGACATCATAGAAAAGTAATAAATGCCACTCATTCGAGGTAATTGCTCAT
TCCTCCCATCATGACGAAGGCCAAGCAGTTCGTCGAGTTCGGGTGCGTTGCAACCAGCTCTACACCACGACTATCCCCACATGACCCTTCCCTAATACAT
CAATGCTGTCTCTCTCCTTATAGTAAGAAGATCGTGGCGATCGGGAAGAATTACGAGGCCCACGCGCGTGAAATGGGCGCCACATCGGCCCCGAAAGACC
CCGTGCTCTTCCTCAAGCCCACCACAAGGTGACAATTGCCGATGTACACAGTGCTAGATTTCATATTAATCGTGAATGCGGATGGCCACCAGCTACGTGC
GCAATGGCGGCAGTGTGTTGCTTCCCCCTGGAATCGGCGAAGTGCACCACGAAGTGGAACTCGGTGTAAGCTTGGCTTTATTCTTTAAACTTATTAGTAT
AAATCTGACAATGACGTTGCATTACAGGTGGTGATTGGCAAGGGTGGCAAGGATATCCCTAAGAGCGCCAGCATGGACCATGTCGCCGGCTATGTATGTT
TCGATACTGCGTGACTTTGTTTTCCTAAATATTTAAATAATATGTGGTTACTGCTACTAGGCATTAGCGATCGACATGACGGCGCGCGACGTACAGGCAA
AGGCGAAGAAGGCAGGATTGCCGTGGACGCACGCGAAGGGGCTTGACACGTTCACGCCCATCAGCGACTTTATTCCCAAGTCTGCAGTGTCTTCTCCTCA
CGACTTGAACCTCTGGCTCAAGGTGGACGACGAATTGCGTCAAAATGGCAACACGAGTGACATGGTGCACAACATTCCGTTTTTGATTTCCTACGTGAGC
CGCATCATGACGCTGGAGGAGGGTGACCTACTCATCACTGGTACTCCGGAAGGTGTTGGTCCAGTACCGGCTGGCAGTGTACGTTCTTGTAGTTGAGCTT
ATTTGTTGTCATCTTTCTCACATTTTCTCCGTGTTTCCTTGGCTTTATTACCTACAGGTGCTTTCTGCGGGTATTACTGGGCTTATCGACGTGCGATTTC
CTGTGGAAACACGCGTGTACAAGGCGTAGGAACCACGCGTACACAAGGCGCAGACACTCGCTCGGATTTTACGTCAGCGCTCCCTGGTTTCTTCCAGACG
AAAATCATGAAGCAATGTTGCAGGAAGCGACCAGCAGAATTACATGAACGTTTCACGTTCTGGGGTTGCTCGCAGAGTATAACCAATTACCAGGCAATTC
TAACATTGTGTTATGGGTGTTGTAGCTGCATCAATGAGCATAGAGAATTTCCGGAAGTTTTGTTTGCGTTTTGGTCCAGCGAAAGTTGTTCGGACATGCC
AGCCGCGGTAGATAGCCTGAATACGCAACGCTGCCGCATCGTGCCTCAAGTTGCGTACAGCAGAGTGAGCGTAGGATCGGACCTCCGACCGATTTGAAGT
CGCACGGATCAACCGCATCAGTGCACCTAACACTCCGCTTTCCACTAGCCTCGAACGTGCCACATGCAACTCTGACACGGCAGCTAGTGCACGAGTGGCC
TCAATAAGCAAAGCCTCGCTCGCACCTTTGTCGCTGCAGTGCCCAACTGTATGACTTCGATCCAGTGGGCTCACGTATCGTACAAGCACCGGCAGGAGCC
CCGCATCTACAAGTTTCAACACATTTTCTGGACGCTCAGCAAAATTAGCTATGATCTGAGCTACGTGAAGCCGCGTAGAAGCGAGTGGATGGAAAGCGAA
CTGTCCCAGTGCTGACAGGAGCGCAGGTTTACACAACGTTAGTCGTGAAGGCGCATCGTGCGTGAGTTGCGCGAGAGCGCCCAGTGCATCCACTTTCATG
CCAAAGTCATCGCCAGCCAGGATGCCAAACAAACATTTGACAACACCACGGGCCAACAGTTCGATGTAGTGTTGATAGTCTCGCTCGGAAGTTTGCTGCG
ATTCTGGAGACGTTGTGTTTGAGCTCGCGGCATCTTCTGTTGCAGTCACCTTGTTAGGTTCTTTGCGTCGTTTGCGCTCGGTACAGATCAACAATGTGAG
CAGAGTGATGACAGTGCGACGGACGCGCTTGTCCGACGACGCGTACAGTTCACGCGCTGCGATGTGATCCAGCACCTTCGATCGAATCACGTGCTCTCGA
TTTGCAATATTGCGGGCCATGGCGCAGAAGATCCCTAGTACTGCACGAATAATTGCTGTAGCTTCGGAGGCTGGCCAAATAGATGCTGAGCGCATTCGAA
GGCGCGTGGATGAAGCTGACCCAGGTCGCGATTTTGGCGCTTTGGATTGAGATGGTGCCAGTGACGCAGTCTGTGGGCGTCTGCTAGTTGGATGAGTAAC
TGGTACGCCGCCGTTGGAAGAGAAGCACAATTGAACAAGCCGCTGCATTGCTTCGGCTTGCACAAGTGCTTCGTGATTCGTGTCATCCTTCGCAACTGCA
TCGAGAATGGCAACCACCAGCAGACTAACTTGAAGCGATGGTCTAGTGGCGCAGGATGATCCACGACCAAGGACATTGAGTACGTAGGGCAAAAGCCCAA
TCAAAGCAAACCGCCGAGCATTTTCTGTCTCGGAAAGCAGCAAATGTACGAAACTCAGCAACTCGCGACGGAAGATGGCATCCTTATCCAGGAATGGATC
TCGTAGTAACCCCGATAATGTCGTAAAGTGACCTGAATGGTAGAAGAGCACCCTGTTGTCGCACGAGGCAGCTAGCTGGTGCAGCACAGAGGCAGCTAAA
ATGCGCGTCCGGCAATCGCCTGCCCCACCACCCCTCGCGCTCTGTGGTGCACCACCACCAGAACAGCAGTTCAACATGAACGCAAATCCTTCTCGCTTGG
CTACAGCCTCTCGCCACTCATCAGTAGTAACCAGTCGCGCAACGATCTCAAAACCTGCCAGTCGTAGTTTTTGATCTGTTGTCGTGTGAAGCAAGGAGAA
TACACAGTCAATCCCTCCTGGTGCTTGTAGAAGCTTGTTCTTGGTAGTAGACAATCGCACAAGAGCAGCTAATGCCTGCGCGCAGTCATGAGAAATTCCT
GGGTCTTCTCGATCTACAGGCGAGCTCAGCATAGTCAGAATCGCACCGAGCGTGCCTACTTCGTCAAGAAGATCAAGATTTGCACCTGGAAGCAAATATT
AAGCAAGAAGAGGGTCAAGATCTTCAAAAGCAAGGGGTATAGAGAAAACGTACTGTTGCGACTCAGAGACGCAATAGCGGCAGCAGCATCACGTCGTACC
TCCACAAACGGTGACCAGTACATGATTTCAATCAGTGGACTCACGTCATCTGCTTCGACGTCTTGGCGTCGAAGACTCTTGAGGACTTGAGCACTATTGA
GTGCATCTCGGCGATGGTCACTCTGCATGGCGTTTAGCTCTGCCTCTCGTGCCAGTAGTTGTTGCCTCTTTGGATCTGCACGAAGAGAAGTTGCAGCACT
TCCATCACGTACTCTCTCTGGCGCTTCAATTGCGTCTACCTTGGTCATGTGTTCGCTGCTACGACGAATCCGCGTTGACTGTGAGACCCTGCGACGTAAG
GGAGGGTTGACTACGACACTCTGCTCCTCCGTCGTTGGTTTTGGTCTTGAGACTTGACCATCGTCATTGCGATTCATCCTGCTATCTCTGCGAGCAGCGT
TGGTTGTGGCTATGGCAGCTCGGAACTGCTCCCGAGGATCCTGTGGTGCTGTCCGCGCTGTTGCTACATCGGGTAGATGCTTGGCACCTGCTGTGGCTGG
ACGTTCCGTTCTTGTAAACGCTAGTTGAGTCGGAGCTGTTGGAAAGAGATCAGCTGGAGGAGCATTCCACCGTCTCTTGGTGACTGTGGCCGCGCTTCCA
GGTCGCAAAGATACTGGAGCTCGTGGTTTGGACGTCAGGGCGGCGGGAGCTTTGGCACTCGTCCCTAGCGGCATCTCGGAATGGATATGTCATTTTCGGC
TAAATTTAGTCTCCATTAGGTTTTGCATTTGGTCTGCATTGGGTCTTCAATAGGTCACTTGGAATTTGTATCGACTCAATTTACGCCTCAAAGTCGAACC
ATGAAGAAGAAAGTGGGGCGTCTCCCTCGTCTCTCCCTGATTCAGCGTCTCAACGACTTAAAGCATCGAACCATGAAGAAGAAAGTGAGGTGTCTCCCTC
GTCTCTCCCTGATTCAGCGAAGTGTCTTCTAAACTGCACACGCGTCTGTTGTGCGTCTGTTGTCTCTAGGTTCTATTGATGGGCAAGTCCGGCTCGGGCA
AGACGTCCATGCGCTCCATTATCTTCGCCAACTACCTGGGTACAAAGACTCCTTTCTCTAGTATCCGTCGCACACTAACACTACGCTCTCTACTGTATGA
TAATTGATCAGCCCGTGATACGATGCGACTGGGACCCACATGTATGCGGTTAAGTCACACTTTAATGACGGGGATACCACGAGATTGACGGGCTTTTGCT
CTTGTAGTGGATGTGGAGCACTCGCACGTGCGATTCCTAGGCAACTTGGTGCTGAATCTGTGGGATTGCGGAGGGTATGACGACAGGGAAATGCTCTACA
GTCTGATACACAGAAGATGAAGCTGATTCAACTGCTGCTTTGATGATTCCAGCCAGGATGCCTTCTACGAAAACTACTTCGAGAGTCAACGTGATCATAT
TTTCAGGAGTGTGGAGCTGTTGATCTACGTGTTCGACATTGAGAGTCGCGAGATCGACGTACGAACTAGGATACCTACGTTGGGAAGTAGCAGAGCTCGG
TGATACTAAATTTTGGAATTGGTGACATGTTACAGAAAGACATGGCCCACTTTGACGGCTGTCTGGAGGCCATCGACCAAAACTCGAGCAACGCAAAGGT
GTTCGTGCTGATTCACAAGATGGATCTCGTGCCTGAGGACCAGCGTGAGCGCGTACGTTGCCGGATTTGGTTGTTTTTGTTGCGGTATTAACGCTTGATT
GAGCTCTATTATAGGTTTTCAACCAAAAGAAGGAGATGATCTTGGAGCGCACGGGGCAGCTGCCGACGGTGTGCTTTGGCACGTCGATCTGGGATGAAAC
GCTGTACCGCGCGTGGTCGTCCATCGTGTACTCACTGATCCCGAATATGCAGGATTTGGAGAAGCACTTGAACAGCTTCTGCTCCATCTGCAGTGCTGAC
GAGGTGGTGCTATTTGAACGTGCGACGTTCCTGGTGATCTCACACGCAACGCACACAAACCACCGCGATATCCATCGTTTCGAGAAGATTAGCAACATTA
TCAAGCAGTTCAAGCTGAGCTGCAGCAAGACGCAGGCGCAGTTTCAGGGCATGGAGGTGCGCAACGCGAACTTTACAGCCTTCATCGATTTCTTCACCGC
CAACACGTACATCATGGTCATCATGTCCGACGACTCGATCCGTAAGTTGCTTTGTGCAAGGTGTTGTTTGCTTCGAGTACCACCGTCACATAACCACTCT
AATTGTCCGCGTGTAATTTGATCGAGTAGAACCTGCGACGATCCAGCTGAACATCAAGGCAGCCCGCCCAGTGTTTGAGGAGCATGTGCAGCAAACGAGT
TAAGTGCATCATTGCAGCGCTATTAGCTTTGATGGACAGAAATTCCACCATTCAAGAGTTGGTTCACGTACGCTGATACCTGCTAACTCGTGTAACAGTT
GCTAAAGCAAATGAATGAGCAGCTTCCAGCGTGAGTTCAAAGACTTTTATTCCATGTACGTGTCTAGAGAGCTCCATGATCTCTGCAGCGTTGGGGGCAA
ATTACACTACTATTGTGGCGGCGGACTTCGGCTGGACGACGAATTGGTTGCAGCTAGCATATAGCCTCTGCGCCTCAGAGCACGTAGAACCACTGGCGTG
ACAGCAAATGTGAGCGGCCATCGGACAGGAGCCAACACTTTATAGATCGTGTAGGCGATGAGGAAGGATCCAGCCGATTTGGTAGTGGAATCACTGATCG
ACGTGGACAAGCCCACCGAGTCCAAGATTGCCTTCACATCCACACCACTAGAGACCCCCACATAGATGACAGAGAATGACAGCAGTGACAGCACAATGTG
TGTGCAGATGCCGACGCGGCCATACTCGATGGCGAAGGTCTTGGCTCGTTGGCGCCACGACTGTGGCTGAAGTTCGTCTGTTGGTTGGTCAAGCTCCTTC
TCCACATCGTCTTCATTCTGCATCAATACAACAACAGCCACGCGTAAATTTCAACACGAGGCAGCCATGGTCGAGAGATCGCACCTTGATTGGGGACGAA
GACGTTGGCTCTCCACGTGTCAGCGGCTCCGACTCCTTTGAGTCCTGGGACGTCCTGCCACTGGACCAGAGGCGGGAGTTAGTGCTGCGACTCACAGCAA
ATGGCTGCGATGGGAAGCCAAGTACACGACGTGACGCAGCGGCAGCTTCTGCTCCAACAGGTCGCGGGGCTTGGGACCAGGAGACGCGCTTGATCCTGCT
GTTAGGAGCTATAGACGACAGAGATCGAGCCACGAGGGAGACGGAGCCGACGCCACGCTGCGTCACGCCGCGATACACGCACAAGTACCTCATTCCGCCG
CGCAGCATCATGGAGAAACGAAGAAGATGACGACTAGCTCGATGATTGCGAGTGTCAGCCCTATATCATACACATTTGGGAAAACAGGAAAATGGCTCCG
TTTTTAGTCATTTAGTTTAGAGGCTACACTAAATTGTGGTGTGTACCAAACACGACAATTACCATCGGACACAGCACTTCAACAAACTGCCGCAATTGAA
GAAAGCGATCACCGGCTTCGATGCGTGGCTTGTGGGTGGCACGAAGCGTGCTCCGTCGCAATGCACGCGATGTGTTAGCTACCGATGCGACTTCCAGACT
AGCGTTGCGGTCGACGCACGCCACTCCGCGTGCGTACTTTTCCACTAACAGCGAGACTGGTACAAAGGAAGATTCGTCCCATCAGCGTCAGCAGTCCTCA
TTCCTACGCAGCATCGACCTCAGCAACCCAGTAGCACAGCGTAAACTGTCCAAATTGATCCAGGAGGTGGTCAAGACCAAGGCTAATACCGGGGGTGAGT
TCTCATGATTTACTGTTAACAAGAAGGATGGGATCTTGACTTGTGCTGCTTTGGGGCAGATTTCGTGCCCCAGGTGGTGATCCAGAGCCTCTGCACAACA
TACCGAGGCATGAACATTGACGAGAAGAAACAATTCCTACTTATCTTGGCGCAGGACCTGCATATTGATACGACCTTGGTGGGTATTTACTACTTGCAAT
GGATACCTGTTAGTGCTGACATTTTGTTACTGCTATAGGCTCTGCAAAGTGCTGTTCAATTTGAACAAAATATGACTAACGTGAAGTGTGCTCGTAGTGG
CTTGATCGACTGGGAACATGACAATGTGGAGAGATACTTGCGCACGTTCCGCAACCTTCGTAACGCACTATCACCGCTCTATGAGGTAACAAGTGCTTGC
AGTAATTCAAGAGCTGACGATATTGACAAGCTAACAACGACGATGGTTACGATGTCAGACCTTCTTCCAGCAGATCTTATCGCAACGAGAAAACGGTATG
CTGTTCTTGGTGCACATGCGCGCAGACCTGTTGCAAGTTCTGCGCAAGAGCGCGACCCATTCTGAGATTCCTGCTCTGCGCTCACTTGATGCGAGCTTAA
AAGTAAGTCTTTAGCTATCTCCTCATCGATTTTTGCAGTGACTTACAACCTGTGGCTTTCATCTCTTATAGCAATACTTGGCATCATGGTTTAGCGTTGG
TTTCCTAAAGCTGGAACGTGTGACCTACGAGCATTCACCTGGCCAGCTCTTGGAGAAGATCATTCGCTATGAGGCGGTGCACCCAGTAGGCACGATTGCT
GAGCTAAAGAGGCGCCTCGGTACGTGTCGAATTAGGGTGATTGAGTATGTGCTCCGTTGACTAATAGATGTCAATTCCAACTGATACTTCAGGCAATGGG
CGCCGATGCTTTGCTTTTTTTCATCCCAGGTAAGATCGCTTCAATTGGAAGCTATTGAGGCTCAAACCTGACTTCAGGATTATGTCTTCTCGATTGTAGC
ATCCCAGATGAGCCATTGGTCTTTGTGCATGTAGCATTGATGCAAAATATCGCTTCTAGTATGCAGTCTATTCGTGATGAAACGGAGCAATTGGCAGAAA
CCTCTCAAGCAAAAGCTGCAATATTCTACTCCATCTCTTCGACGCAGAAAGGGCTTTCGGTGAGGCTCATCGTTTTAGGGTTCATTCTGCGAACTTACTC
AACCGTATTTGTTACGTGCCGTAGGGCGTGGACTTGGGCAACTTTCTCATTAAAGAGGTTGCCAAAGCTCTCAAGACAGAGTATCCACATCTGAAAACGT
TCGCAACCTTGAGCCCTCTGCCTCAATTTATGTCGTGGCTCGAAACACAGCGGTACAAGACTGATGAGTCGTTAGTATCTCCACTTGAGTTGGATGCTCT
GATTGACGTGCTGGATGTGCGTGGCACTACCATCCAATCGGACTCGACTCCTGTGGCCATTGTTTTGGATGCACTTACGATTGATGATTGGAGCGAGGAT
CCAGAATTGGTTGCAGCGTTGAAGCCTATCATGCTAAAACTTGGTGTGCGCTACATTTACCACGAGAAAAAACGCGGGAAGGCACTGGACCCCGTAACAA
ATTTCCACGTCCGAAATGGGGCAATTTTCGAGCGGATCAACTGGCTGGCGGATCTGTCCAAGAAGGTGCGTGACTTAATCTCCGTATATTCAGTGCAATA
TGTATGACTTTCCTTTATTTTGTTGGTTCTTATGCTTTCCTGTGCTAGGGCATTGCTCAAAGCGCTGGTATGATGATCAACTACAAATACGATTTGGCGC
ATGTGGAAACAAACAACGAGAACTACTTGTTGCACAACATTATTCCCATTGGACTTCAGCCGCAGCAAGTGCTTGGATCACGTACCATTTAGTTGAGGGC
ACGAGTGGATCTGCTTCATGTACGGTTTGTTGATAAGATTGGAATTCAGATTTGCCACAGCCACAACGTCTCAAACTATTCATTCTCGTGCTCATTTTGG
TGTTGTGTGAAGGGTCGTACGTGGCACTGCAAGTACATCAGTGAAATTGAGATGGTGCTTGCACAAGACGAGATCGACGCTTGCCGAGAGGCGTTCCTGG
CATTCGACAAGGATCGGTGAGTGTATTGGCGGTGTGATGATAGTAAGTGTAATTGCTGATAACGCGTGAAATTACAGGAGCGGTACGATCGATGTCTGGG
AACTACGGCAGGTGCTCGAAGGTACGGTATGCACATGCCTCCGTGTCTGATATGTACCGTTAAAGTTAATCGACTGGTATTAGCAATGGGGCAACAACCA
ACTGAAGAGGAATTGTTCCAGATGATCAGCGAGGTTGACGAAGACATGAGTGGAGCTATTGGTACCCAAATTTACTTTGGTTTCAAATATTTACGAGTTC
AGAGGAAAACTCATTATATGCGTGTTAGACTTTGCTGAGTTTCTGCAGGTCATTGATAACCAAAAGGATAGAGCTGCCATGTTCGAAGATGATAGCGACA
TGAGTACGACTTTCTTAGTCCAAATAGTCATCATTATATTCGATATGACCTACTTATCGTTGGTTTTGGTTTATAGTTGATGCATTCGTTGCATGCGGTG
GCAAGCCAGACAAGTCGGGGTTCGTACGCAAAGAGACACTGGTGAGAATCATTAAGGGTGACTTCGGTCTTACCATCAATATTGAGGAGATGATCAACAA
GCTGGACGTGGACGGTAGTGGAGAAATCGAATTCGACGAGTTCAAAGCCATCCTGACCTGACCTGGTGATTAGGATCTGAGCAA