Description :
From Genome Similarity Track
Location :
Scaffold_2303:173- 2887
Sequence
2714 bases(100 bases per row)
TCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGA
AGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTA
CAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATC
CGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACG
TGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGCGTTTTCCAGATCCGAAGTTTCTTCAACCCTGGATCTACACAGAGGA
GAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTG
GATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGC
CAAGGTAGAGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGG
TACCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTT
GTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCCGGAGTGAGGTTGGATCT
GGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAG
ACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTAC
CTACCGTAATCCAAGGACCAGGTCGATCACAATATCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATG
GTTGGCGAAGGATGGTATCCCTAGGCGACCTAATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGA
TCGAATCTCTCGGGGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATTGGCCTTCATACCAAACTCCGCGAAAGATCCTGCAGAGGGATCG
TCGGACTGAGGTCCAAGCGACGGAGGTTAGATCCAAGACCGGGGATGATCCCCAGCGTCGGCCCCTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAG
AAGGCTGAAGCCGGACCGCCAGATCCCGGTGACCCCAGAGTGGATCCTAACTTTTCATGGGGCAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAG
TCAAACCAGAACCGTCGGGTTTAAACTCGCTAGAGGATCAACTAGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGAAGACAGAGGG
ACTTACAGGTGAAAGAGAGTCGCGGTGCTTGGATCCAATGGCGGATCCGACGAAGACGGAAGATGAACAGGTCTGTTACCATGAAGGCGGGGATCTACAC
GCCGAGGATCTCGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATGTCCAAGTGGATCCAGAGGCGAACG
AACCCGCGGAAGTGGATCTGTTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAA
ATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGGTTAAGGGCCTG
CTGCAAGCCAAGATCATCAGTTTCGCAACGTCCCCGTGGGCATCTCCGGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGAT
TACCGGCTGGTTAACAGCCTGACTCGATTGATGGTATATCCGATGCCTCTAATCAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTATC
TAGATATGGCAAGTGGTTTTTGGGTGGTGACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTGGGCTGTTCGAATGGAGCCGGAT
GCCGTTTGCATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAATGCCCTCTACGGATTTACCCGAATACCGTAAGCCGAAGGGGATGGATCC
GGGGGAGGTGACGCGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGTTGATCTGGGAACCCCATCCGTGTTAGGGCGCAGATCCTATAGCGACGACATTC
AAATCCCGGCGGAA