Description :
From Genome Similarity Track
Location :
Scaffold_1703:173- 2589
Transcript NameFunction/comments
Phymu_g13567hypothetical protein PHYSODRAFT_341850
Phymu_g13568hypothetical protein

Sequence
2416 bases(100 bases per row)
GCAGCACTTCCACTGGAGGAGCCTGTTCCGAGACGTACAACGATACGTTGGTGAGTGTGTGGATTGTGATTTNCGCGTCTGTTCCGAGACGTACAACGAT
ACGTTGGTGAGTGTGTGGATTGTGAGACTGGGAAAGGAAGACCTACCATTCAGGGAAGATCGCCCGGTAACCTGCAGGCCACCTACCCGTTCCAGATAAT
CGCCATGGATCACATCCCCTCGCTGCCGAAGTCGTACAAAGGAAACACGGAGCTTCTGATTTGGGTGGATCTGTTCACCGGGTACGTGCTAGCGAAAGCG
AGCNCAACGACAGAGTCCGACGATGGCATACCGGCCGCAGGCGAACGGGACAGCAGAACGGATGGTTCAGACGCTGACTCGCTCAGTAAAGATGTACGTC
GTCGACGTGAACCAGAGGGACTGGGACGAATACGAAGAACGATTAACATTCGCGCTGAACACGGCTCAAGATTGAGTTCGCGGCGACACTCCGTTCTTCC
TGGTTCATGGTTGGGATCCAAGATCGACCTTGGAAGCCACATTGCCTGTGGGGAACACGCGTCGCAGGGATCGCGATCCCCGAAGGTGGCGTGATCATGT
GCAGCGCCATTACCAACGTGCCCGTGAGGAGGTGAACGAACGTCTACGCGAAGCTATCCGAGAACGAGCCGATCACCACAacgaagatcttcgtccACTT
TCCATTGGGGCCGGAGATCAGGTCTGGCTGTACCTGGACCGCGTTAAGGTTGGCTACGCGCGGAAGCTTGCGCACCTCTAGCATGGACCGTTCCGGGTCG
CAGAGATGATCGACGAACACGCAGCAAAGCTGGAGATCGCGGGGACTGAATACCGGATCTTCCCGATCGTACACGtgtcgaagctcaagccTGTGAGGCA
GTTCCCGGACCGTCCGAAGCTTGAGATCGTCGTCCCCGACGAGGAACGCGTGGACTTTGACGAAGCGTTCTTACCTGAAGACAGCTGGGAACGAGTGTta
gacgaagacgagtaTGAGGTGGAACGTATAGCAGACGTACGATCGTCCCGGAAGACGCGGTATGGGCGAAACTGTCGCGAGTTCTTGGTCCACTGGAAAG
GGTATGACGATCCTACGTGGGTAGCGAGGTGGATTTGAATTGTGGGGCTCTGCTCCGCGAGTTCGAAAGAAGCCAGGTCAACCGCAACCGGTTTGGAGTC
ATGCAAtcccacgaagaagaagtgggtGGCGCCCCTTCGCAGTAGGTGCGAAAGGGGGGAGAGATTTGCGCGGGGAGGCCGCACAAATGCACGATGGGTT
ATTTGTTAAAGTGAGTACAAGGGAAGATATCTCGGGAGAATATTTCAACTCTGCCTGGGAAGAACtaagcgctggaagagaatCTAGTCGCTATCGTCTG
CGGAATAAAACTTGCGGTCCAGACGCATCAGGCGGGATCCAGGGTGATCCGCGATGTTTGCTCGATACTGGTTGCGCCACGGGTCCCCAGCGTCAACAAT
CGGAAGAGCGGCGAGGAGATCGGTGGGACGCTGTCTCGCACCGAGGCCCGGATACCACTGGACCTGCTCGCCGCGTACCGGAAAGTGCAAGAAGTACGGG
TCCAACAGGAGGTCCAGGTCGCACTCGCCGTTGTTGAGTCCCTCCATTAGGTGGACGAGCAGTCGCCGCCACCGGGGTCCAGCGCGCATCCTACGCTGAC
GACATTTTTGCTGATGCTGTTTCAAGAATGGAGACGCCGCGCGCGCCGAGGCGCTAAGAGGCAACTTGTGTGTGGTCTCCCAAAAGACTTGGAGATGGGT
GTCCTCGAAGATCGAGTACAACCGACAGAATTCAGCGAACCATCCGTTCACCTCGAACGACCGCGGGATCACGAGACGACGCATAGCTTCCCAAGGAGGA
GGTGTAGCAGCGTACAAGGCACGAACGTTCGTCTCGGTGATCAAGTCTGGAAACCACTGACTCGTGCTGGGTGCCCGCGCACTCTGCGGGAATAACCAGA
ATTTGGGTCGGGTCCACTGACTGGCCAACGCGTCCAAACGCAATCGTCTCACGCTCAGAAGGCGTACGTCCTGAAGAGGCCAAGGAGTGCAGTCAGCGGC
GCGTGCATATAAAGTAGGTCGTCGATATCCAGGTATCCATTGGCTGCGTGGGATCACCGTATCCAAGAGATCGCGATGCTCTTGCGAGCCGAGAAGACTG
TTGTCGGACGCGTGCGAGGACAaagagcttgagctgtcACTGCGGTTGCCACCGTTCCCGCCATGATCCGAACTGCCGCCACTAccgtcgctgccgtcat
CGCTaccgtcgctgtcgtcagGACTGAAACCGCCAGAACCCGGACCACCTCGACCGCGGTCGGATTCCTCTTCCTGGGAATCCTGTTCGGGCGAGTTGTC
AGGAAGTCCATCGTCG