Description :
From Genome Similarity Track
Location :
Scaffold_250:173- 2155
Sequence
1982 bases(100 bases per row)
CTAGACGAAATTTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGAAGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCT
CATTAATGGATGAGTCAGTCTTAGAGGATATCAAGGCGGCACTCAGTGCCCAAAGTGGATCTTCGATCCTTAGGGATCCTTTGAATCCCTTCTATCCTTT
GGTAAAGGAATTTCAAGATGTGGTGTGTCACAACCCACCATCTGTCATACCTCCCGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAA
TACTGCGTAACACGGCAAGTGGTCTTTACCTAAGGGACAGTGTGACTTCATTGACAATTTCTTTCGTGCTAAGCACGCGGCGAGAATGGTGCGGGAGAGT
AAGTCTCCCCAATCTACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTCAATGCTGCCACTATCCCGG
CTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTATAGTGCGCTCGACTTAGTCGATGGTTATTATCAGCTGCT
AATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCT
ACTTTTAATCGTCTAGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACTTACTTTGATGACATCTTTGTCCATAGTCGTGCAGCGAACGGTC
GATCTGATGTGGATAATCACATTGATCATTTACGAGCAGTGCTCGAGTGCATGCGCACGAATAAATTGTATGCAAATGCATTTAAGTGCATCTTTGGTGC
AGAAGAGATTCCCTTTCTGGGGGCTTCATTGGGAGGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGTCCATCGTCGATTGGCCGGTTCCAGAGAACC
AAAATGATCTACGTAAGTGGCTTGGCATTGCCAATTACTTGCATAAGTATAGTGCGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAA
GGATGTGGATTGGTGTTGGGGTAACACCGAATATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGAT
CGGCCTTTCAGTGTCGTCTGTGACGCATCTAACTTTGCCATAGGCAGTGCTCTGTTACAAATAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAAC
TCGACAGCTCAAAGCTGCTGAAAGAACTATCCAGTTCATGACAAAAAACTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGACT
CAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTAGCTTTCATTCTTTGT
CGAATATAACTTCGAAGTGAAGTATAAGCCAGCAAAGCAAAATTCTTTGGCTGATGCGCTATCGCGCTGACCTGACTATGAGCTTGCTCACGTCACTACG
CTGTCATATTCAGTCACTGATTTAATCAGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGCAACGAGGAGTTAAAAGACT
CAGACATAGAATTGTCGGCACGTTTACGTGCAAGGCTACATAGATATTCTATCGATAATGGCCTGTTGCGCACATATATTGAGGATAACCCTCGTATCGC
TGTCCCTCATGATGAGGAGTTGGAGTATCGAATCCTCTATGAGGCACATGATACCGCGTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTG
AGCTAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCAACTGTGTGCGTACGTGTGAAACGTTTCAACGGGTTAAAC