Description :
From Genome Similarity Track
Location :
Scaffold_12:173- 1654
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.0Ubiquitin-activating enzyme (E1)

Sequence
1481 bases(100 bases per row)
AATCGGACTACTTTGAGTGTCAAAACGAGTTTTCAGTGGTTCCGCGATGGTCAAGGCAGTCTCAGGGCTGGTGGAGCTGGCGGCTGCGTTCGGCGCCGGC
GCCGTGGTAGCGCTCGCCGCCCAGCAGGCCATCAAGGCTCTCAGCAACAAGAGCGACCATGTGTCAGTCCACTCGTCCAGTGCTGCTGACGATGCCAAGG
GCTCGGACGCGCGGGAGCTGGAGCTGCTGACCGAGCAGCTCTCCCGCATCCGCACGTTCTTCGGCGACGACGGACTCGCGGCCATCCAGGACGCCTTCGT
GATCGTCGTCGGACTCGGCGGTGTGGGCTCGCACGCCGCGCACATGCTCGCGCGCTCGGGTGTCGGCAAGCTGCGGCTCATCGACTTTGACAACGTGACG
CTGTCGTCGCTCAACCGCCACGCGGTGGCCACGCGCGCCGATGTCGGCACGCCCAAGGTCGCGGCCATGAAGCGCCACCTGAAGCAGATTGTGCCAGACT
GCGAGGTGGAGGACATCCCCGTCATGTTCGAGGCGGACTGCGCTGACGAGCTGCTTGCGGGTGGGTTCATCTGCTTTTGAGAGGTTGGTTCGCACCTAAC
TGTGAGATACTCACGCGGTGGTAACGCTGCTAGGGAACCCGACGTATGTGCTGGACTGCATTGACGACGTGACCACCAAGGTGGCGCTTCTCGAGGCGGT
GTCTGTCAAGAAGCTCCGTGTGATCACGTCGATGGGTGCTGGCGGGAAGGCTGATCCGACGCGGATTCAGATTGGATCGCTCAAGGACGCCGTCCGTGCG
TGACCGCTTTTGTGTCTCCCCATTAACGGCGAGGTTGTGCTGATCTGAGATTTTGCGTCGATAGGAGACCCACTGGCGACCAAGATGCGCTACTTCCTCA
ATAAGAAGGGGCTCTCGACGTCGGAGATCACGACAATCTACTCGAGCGAGAAGAGTGTGTGCAAGCTGCTGCCGCTGGACCCCGAGCAGGCCAAGAACCC
GGACGAGTTTGGCAACGTCGAGAACTTCCGGATCCGCGTCATCCCCGTGCTGGGCACGATGCCGGCGCTGTTCGGACAATCCGCGGCCGCGTATGTGCTG
TGCGACTTGGCGGGACAGCAGTTCAAGCCTGAGGCCATCGCTCGGCTGTCCCGCGACCAGCGCAACAAGCTGCACCAGAAGCTGCAGCAACGCGAGCACG
ACCTCTTCAAAGAGGGCAAGAAGATGGACCTTGAGAAGGACGAGATCGAGTTTATTTACCAGGAGATTTGGCGGGGACGCAGTGCGATCAGCGGCGCGCG
TCAGGGCGGCCGCGATCGGCTGTATCTATCGCGATGGCGGAAGGAGCGGCCGTTGCAGCCGGACAATGTAGTGTTTCTCACGACGAAAGAGTTGACGGCG
ATGGACGCCAACGGCATCGAGGGGTTCGGAGAGGAGGCGGTTGCACGCATTGATGCGCGACTGGCGGCGTTTGGCGGGTGG