Description :
From Genome Similarity Track
Location :
Scaffold_2338:173- 1300
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2338-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1127 bases(100 bases per row)
AGTTCACGGTGCGGAAGGCGAACGAGATGAGCAGACCTGAGCGCGGGTACTTCATCATGGGGATGATCGGCTCTGCGATCAACGGCGCGGCATTTCCAGC
ATCGGCCGTTCTCATCAGTGAGCTTGTGGCCATTATGACAATCGAATACACCAAGTACCAAGCGACGGATGATCTCGGCGAAATGAGCGATCTACCGCAT
GAGGTGGCGATCTACGGGATTCTTTACATCGCTGGCTCGGTCGTTCTACTCACTGGCGCAGCCATGCAGAGCTACGGGTTCAAATATGTGGCGGAGAAGC
TCACTTCTCGTCTGCGCGACCTGCACTTCTCGTCGCTTTGCCGCCAGAACATTGGCTTTTTCGACAAGAAGGAGAATGCCACCGGCGCGTTGACGGCAGA
TCTCGCCACGAGCGCGCTCAAAGTGGCTCTCATCTCCGGCGAATCGCAAGGCCGTCTGTTCCAGGCCGTGTTCACGACGGTTGCGGCGCTGCTGATCTCC
TTCTTGTCTGGCAGCTGGCTACTGACGCTAGTTATGCTCGCCATCATCCCCGTGCTTGTCTTAGGCAACGTGTTTCGGTCGAGAAACCTCCGCGGTCGCG
GCACCTTGTCGGATGATTTGGCCGAGGTCGGTGCACATGCGTCGGAGGTGCTTGGGAACATTCGCACTGTGGTTTCTCTCGGCCTTGAGCGCTCAGCTTG
CGAGAAATTCGACCTGTTGCTGGACGAACCGATGAAGAACGGCAAGCACGAGGCACAAGTCAACGGTGTGGCTGTCGGCTTTTCGTCGTTCATCGTGTTT
GCTACCTACGCGTTCGTGTTTTGGTACGGTGGCAGACTGGTGGACCACGGCACAATCACGTTCCGCCAGTTGATGCGCACACTCATGGCCATCATCATGT
CCTCGCAGAGCGTCGGCGCGTCAGTCGCGTACGTTGCTGAAGCGGATAACGCCTTCTACGCCGGCGCCATCATCATCGGACTTCGAGATCGCAAGCCTCC
GATCGATTCGTTCGATGATGGCGGGCTCCGTCCAGCTCACGTCACCGGCCAGATCGAGTTCAAGAACGTTCTATTCCGCTACCCAACGAGGCCAGGAGTG
ACGGTGCTCAAGAATTACAACCTGACC