Description :
From Genome Similarity Track
Location :
Scaffold_3294:173- 1256
Transcript NameFunction/comments
Phyag_g13172hypothetical protein PHYSODRAFT_332764

Sequence
1083 bases(100 bases per row)
agtTGAGCCACAGCTTCCGGATGGTCGATCAAGTCGAGTAATGGAGTTGCCGGTGTGAATACAGCGTGAGACTCGGACTGCTGCTCAGGAAGTTGGCTCG
GCAGCGACACCGTCGGAGACTGCTGGATGATTAACGCAAGAGCGACGGCGAGCAGAGGGCGGGTGGCAAAATCATCGTCCGGGAAGAGCGACAAGCCTTG
TTCTTCCGATGTCTTGGCACGGATGAAgcgaacgaagaagatgtcACCAGAGCCAATTGACAGGTTTGCCTTGCGAAGAACCGTCAGGTTCTAAGCACGC
CCAAACAGATACCAGAGCAAGCACAGGAGAGCAGCATCCTGGAAGTCAGCGGCAGTAACAGCAGTCGAATACAGATACTCGGTCATCTGCTTAAGTGCCT
TCTTCGTGCAGGCCGGCGCCTTGTTGACGAATGTGCCTGACTCGCGCTTCATGCAGTGTCGCTCCAGCACTTGACCCTTCTTCAGTagattcttctccac
cgctgcgcGATGCTGGGGGAACTGATCAAGCAGCCAGTTCTTGGCCTGTCGGTGGTACTGCATCACCGAGTGTCGGGCTAGGAGTTGTTCCTTGCGACCT
TCATTGAAGGCTAGGTGCATGCCGAACTTGTCCACCTCGGCTTCGAGAATAAGAGGAGCGCTTTCTCGCTGCATGCGTACCTCCAGGTAGTCCCAGCTGA
CGTCTTCGTCTTTCAGGAATTTCAGAAACGTTTTCGCCGCACCTTCGCGGGCTCGCTTCGTGTTGGCAGGTGCAAGGTCGATAAGACTCATAGCTGGTCG
GGGGAGTCGGAGATTGATTGTTATTCGTAAAATATGCGAATGACAGAGGAACTGTAAGAGGGTATCGATATCTTGGAGACGGCTCCCGACGCGATATGTC
GGAGGTGTGAGTACGCGTCCTTCACAATCTCTATACGTCTCTGATCGGTTGAAATATGGTGGGCGGCGATCGTTCATTCGCTAATAAAACCAATGTTGAC
GTAGGACGCATTCTATTGGCCGAAAAGGTGTATAGTGAGTTCTAGTGTAGTCGGAGACTTAATGATattcatccatattactc