Description :
From Genome Similarity Track
Location :
Scaffold_204:17299- 20260
Transcript NameFunction/comments
Phyci_250034conserved hypothetical protein

Sequence
2961 bases(100 bases per row)
CTGCAGGTGATAGCGCAGGCGGTGTCCCGACCGTCAAGATGCAGCTGAGCGGGTCCCTCTTCGTCATTTCCTCGGATGCCTGTACCAGCTTTCGCCACAC
CGGATTGGATTTCATATCACACTGAATACGCTCTTGGCTTCTCGTTTTCGGATCCTTGTAACACATCTTGAGGGCTTCCATGATTAGCTTCAAGTTGGAA
AGTGCATCAGTTCCTGCCATGCTGTCGTATTCCTGTTCACCGTTGCTGTCAATGGTATCTCGGTTGAGGTACACCTTGCAGAGTAGAGGCGCCAGCTTCG
CGTCTGGTCCCTCTGTCTGCAGGATTCGTCCGATGATGGGGCACTTACGGGAGCGTTTACTCTTAAAGTCGCCAATGCAAAACACCAGCATCTTCGTGAT
TTCGCCCAGCAACAAATTCCACATCGGGTATTTCTCATAACACGTGATGAGAGTCGTGATCACGTGGGCACCGACAAACATTCGGTCCAAACGCTTCGAC
TCGTTTGACAACACAGAGTTAAGACACTTAACAACAGACCAGAGATGGTAACCAGACGCCCTGCGCGTATTGAAGGTGATCACTTGTTTCAGGAACACCA
TGAGTTCGTGCCCCTTGCGTTCCATGCACGTGATTAGGCATTCACGGAGGCGACGGTACTCACGCACGTTACTGCGCCAGTCATCACTGCAGAAGATTTC
CAGTTCGTTCAGATCGCCATCAATTACTGCTTGTAGCAAGGTAATCCATGCCTGTTTCTCTTCTTCAGAGGACGCTGCAAAGTATTCGATAGACTTCACC
TCCACCGCCTCGGAATCACTGCCATCTCGTCCGTTTCGACGTTGGTGATGAATCATGGCATTTGCAGGAGTCACAGCACCATGCTGAGAAGCAGCTGCAT
TGTGTGCATCGGGAAGTTTCTTCTTTACAGTCACGCTGAAGCCAAATTCGTGCCAGTCCGAGCTCTGCACGTTCTCCATTTCGTCCAGTGTGATTACACT
TTGGTTACCTAGATTAGGCGTGAATGCTTTGTCCAAGCTAGCCGATTTTGGCTCATCCTCACGTACTTGTGTCATTCGCAGCCCCATCATGCAGTTTAGA
CTCGCCTGGCAAAGCTGTACTTCGTTTTTCAGCTTCTTCTTCACCAGCAAATTGCCCTTACGCATCAAGTGCGTGGAGCACAAAAAGTTGAGGCAATCAA
TTCCCACAGAAGCTGCCGAGTTGCCACCGGCGCTCCGAGTGTCAGTAAACTCCACCGTCTCCGTTAGCTCAAATAGATGCATCAGCATCGTAATGCACGT
TGGGCGGGGATGTCCCTGCGACAGCAACATCAGCGACTCGAGCGAAGCCATGCTGCCTCGTCGCTCCCGTGTCAACGGAGTGCTCCAGAACGTGAGCTCC
TTGATCATCTGCACGAAGAGGTGCTCCAGAGCTGCCTGGTGCTCCTGCATGAATAAGTGAATGAGACGTCGGACCTTGCGGGATGTGTACTTGCGCAGAG
CGGAGTTGGCCGTCTCGCGCGAGGCACCGCAGATAGACACGTACTCGTCCTGGCCCGTCACCTTGTCCAGCGGGATGGTTCTGGCGGAGATGGCCACTCC
GCGCCCTGTCAAATACGGAGCATGAACGATCTCACGCAGCAACAGGAAGGTGTTTTCAATGGAGTCTCGCTCGAAGGCATTGCGTGGAGGAGAAAAGGTC
ACCTGTTTCTGAATCAACTTCTGCATCATGTGCGTCTCGAACAGCGACGTGATGGCCGCCTCCGAGTGTTCCGCGTAGATGAGGTGCAGCAGCAGCGTGC
GGATATCATCATGACCAATGTTAGCCAGCAGCATGTCCACGGTGGCCGGGTGCTCGGCCAAGAAGTGCAGGATGCACGCACCCTTCTGTCCTCGGATGGC
GAAATAGCGCAGGATCTGCGACGCGAAGTTGGCCGAGTCGTGGCTGAAGATGCCGTACATGGCCGTCTCGTTCACCTCCGTCGTGAGCGGCGCCGGGATG
CCCGTGTCGTCAGGTTCGTCCGAGTCGGAGTCCTCGTCCCGCTCCGTCACCCCGGAGATCTCGGCGCTGTCTCGCTGGGCTTCCCCCTCGTTCACCGCCG
CCGCCTCCATCAGCAGCCCGTTCCCCCCGTTGGCCGGCGTCGTGGGGGACGGCAGGGGCGACACGATGGCCGTGACAGCGGCTGCGTCGGCGTCCGCGCC
CAGCGAGGACCTGGCCGAGGACTTTCGGTGCCTGACCAGCTCCTGCTGCGCCTGTGCCTGGGCGCCGTTCTCCTCCTGGTGCTCGGCGAAGCTCTGCTGC
AGCGTCTGGGCGCCGTCCTTCTCGAAGACCTGCACGGCCACCTGGATGAGCTCCTCCAGCTCGGCCACGGAGGCCTGGCGCTCCTTGCGGCGCAACGGCG
TGTCGCAGCGCAGCGAGACGCCGTCGGCCTCGCGCTGCAGCGTGTCGAAGATGGAGTCCCAGAAGTCCGCGCACTGGTGCGGCTGGCCGGGCTCGCAGGC
GCCGGCGATGGCGTTGACGGCGCCGCCCACGACGATGAACTGCGCCGCCATGGCGCGCGTGTGCGCCGGGTAGGACGCGTCCAGCGCCAGGCGGATGAAC
TCGAGCGTCTTGTCGCGCGCGAACAGGATGCCGCGCAGGCGGCTGGTCATGCGCTTGAAGAGCAGCTCCAGCATCTCGAGCGAGAAGCTCTCGTTCAGCA
GCTGCGCCAGCGAGTAGCGCTCGCTCATGAGCCCGTCCACGAACTTCTCGATGTTGGCGCGCACCTGCTCCGCCGCCTTCTTGCGCTCCTGCTGGAACGA
CGCCTCGCTGTGCGTGGGGGACGGCGGCCCCGAGCCGGGCGGCGTCGCCGCGCCCTTCTCCAGCATCGCGAAGGCTTGCGCAGTGCGGAAGCGAGCGAGA
GCGAGAGTGATTGTGGGGCGGGATGGGCGGCATGCGGCAATGTACCACCGCGGCGCCCGGA