Description :
From Genome Similarity Track
Location :
Scaffold_64:172950- 173964
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20941Hypothetical protein
Sappa_CBS223.65SPRG_10806peptidase, partial

Sequence
1014 bases(100 bases per row)
CCCCAAGGTCGTCACGGTCGAACCGAGCACGGTCTCGCCCGGCGTGGTGCTTCAGATGACGGGCGAGCTTTTCCGAACGGGTCCGCTCGCCAAGTACAAA
TTTACCAACGTCGACGGCTCGTTCTCGGCGGTGCACGCTTTCATCTGTATCCAAATCGATCTCTCATGCGACGTCCCCGCACAATAGGACGTCCAGCCGA
CGCTGGTGGACGAGAAGGGAGTCAAGCTGTACAAAGTCGAGATCCCGGCCTTGGGCAAGGCCGCAGAGGGCGAGCTTTGGTTCTACGTTGCGCTCAACGG
TGTCCAGTACAGCACGAGCGATGCTGCCAAGGTCACCTACGTCGACCAGCCCGAGCCACCGACCAAGGACGACAAACGCAAGCACTGAGAAAACCATAAA
CACAATTGTCGTCAACACAACCGCTTGCAATTAGCTAAACATCAATACAGAACACGGTCACCGATCACCAACACAACTGGCCTCGACAACTGGTCTCGAC
GTCAGCACTTAGACGGTGGACTGGGCCGGGAGCTTGCCGGCGGCTTTGAGGTCCTTGACGACATCGCTGATCTTGACGCCGCCGTTGAGGCAGCCGCCGC
AGTTGTGGAGCGCGATGACTGCGTGGTCGTTGGGACTGATGACCGGCGACCCGGACGACCCGCCCTCGGTGTCGACCATGTAGCCGACTTCGTTGGCGAC
GCAGCTGTTGATGTTGAGCGACTCGATCGTGCCCTGGGCGCCGCTGTCGAGGAGGTACCCGATGCGGCGCGGCTTGCCCGCGGGGTGCTGCGGGATGTAG
ATCTGTTCGCCGAGCTTGGGGCCAGACGCGCGCGCCTTGAGGAAGCCGTACTTGGCCAAGCTCACGCCCGACTTGAGGTTGAGCTTCACGAGCGTGTAGT
CGAGGTTCTTGTTGGTACGGATGAAGGTCGCGCTCGTGGCGACGATGGTGCCGCGGCAAGCGAGCTGCTGCGTGTTGTTGGGGTCGCTGCACGTCGCGCA
CTCGGCGCCAAACT