Description :
From Genome Similarity Track
Location :
scaffold_60:172942- 198878
Transcript NameFunction/comments
g6719.t1 polyribonucleotide nucleotidyltransferase, putative
g6720.t1hypothetical protein
g6721.t1 ribosomal protein L38
g6722.t1 conserved hypothetical protein
g6723.t1hypothetical protein
g6724.t1hypothetical protein
g6725.t1 protein kinase, putative

Sequence
25936 bases(100 bases per row)
TCAGGTCAAATGTTTCTCTTTATTTCTGTTGTGTGGACTCTAAAACACCAAGGAGGAGAGGTGGATCTTCCTTGGTAAAGTAACTACCTACTTGGACTGA
GTGCGCGGGCGACGAGCGGTCTTGGGACGACGCTTAGAAGGTGATGCCGAGCGACGGTGGTGGCCATTGCTCGCACACGTCTCAGAGTCCTCGGAGGAAG
TTGAGGCGTCCTCGCTACCGTCTGCACCCAACAGCACACGACGGGACATTTTGCCGGAAGCACCATCCTGCAGGCACTCGAACTCCATCTCTTGGCCCTC
AGACACCACGTCATTGATATTGCTGATCTTGTCGCGCGATAGCTCCGAAATGTGCACGAAGCCACGCTGGCCATCTGCAGACTCAAGGATTGCTCCAAAG
TCCATCACCTGCGTCACACGCATTGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGCTAGAGCCCTGGTTATCATTGTCACGGCCGTTAT
TGTTGTTGGCATTGCTGTTGTTACCGCGAGGGCCAGCGTTGGCAACACCGGCAAGTTCTGTTTGAATCCACTCGCAAGCTTTCTCCGCGCTTCCGGGTGC
GCCCACGACGCGAACAATTCCTTCGCGGCGATCCACGATGCTCACCGAGACTTCGAAACGCGACTCCAGATCACGAATGTTGCTGCCACCGACACCAATA
AGTGCACCGATCAAGTTCGTGGGAATAACGCATTCCATGCTCACGTTCGGTAGCGAGCTTCCACTAGTCTTCAGGTGCTCACGAGGCTCGGCGAGTTCGT
TGCTCATGCGACGCAGCACGTGCAGGCGCGCCTGCTTGGCTTCACGGAGTCCCTCCTTCAATACCGAAAGCGGCACGCCCCCAGGAAGCTTCACATCCAG
CTGAAGTGCCGTCACACCGACTGTCGTGCCTGCCACCTTGAAGTCCATGTCACCGTAGTGGTCCTCCGATCCAAGGATGTCAGTAACCAACTGGTATTCA
CCCTCTTCGATACGCTTCTCCTGGCCAGCAAAGGGGTCGCCAGCAGTAACCAGGCCAATGGCAATACCAGCCACAGCACGACGAACGGGGACGCCCGCGT
CCATGAGCGCCAATGAGACGCCACATACCGTCGCCATAGACGACGAACCGTCTGAACCAACCACCTCCGACGTCATACGCACAGTGTAGGGGAATTCGGT
CACCGACGGCAGAATAGGCAACACAGCCTTCTCAGCAAGAGCACCGTGGCCGATCATGCGTCGGTTGGTGCCACCCACACGCCCAGTCTCGTTCACGCAG
AAGGGTGGGAACTCGTAGTGCAGCATGGCATGCTTGAGAGACGTAGAAGCATCAGGTTCAGCCTGCTCACGCGCCTCATGCAGAGCACCACGAAGGCGGA
CACCACGTTCGAGAGGTCCCAACGTCACGGAGCACAGCGTCTGTGTTTCACCACGTGCAAACAGCGATGAACCGTGTGCCATTGGCAGCACATCAGCCTC
CATCTCGAGCGGACGCACGATGCGAACCGAACGACCGTCAAGCCGCACGGGTTTGTTCTTCTGACCCTTCGTCTCCTTCGCGATGGTCAGAATGCGCTCA
CGAAGCACACGCTGGAAAGTGTCGTGAGCAGCACGCTGGATGGCAGCATCGTCAATAGGAGGTGAAGCAGCAGCAAAGGTCTGACGCATGCCATTCAGCA
TCTTGCTGTAGACTTCGCGCTCTCCCTGCTGGCGAGCAATCTTACCAGCGCGACCACTTGCAATCAGGTCCTCGGCACCCTTGCGCCCCAGCTCCTCCGC
CTTCGCCCAAACCTCCGGCGGGATGTAGAGCGACGAGTACATACGCTTGCGCTTGCCGTGTTCCGCCGCCAGCTTCTTCTGCTCCTCAATAGCCGGTGCC
ACATGCGCATGCGCTAGGTCCAATGCCTCGTCAAGACGTGCCTCCGTCACTTCATCACCCGAGGCTTCTACCATCACCGCACGCTCAGCAGTACCAGCGT
ACAGCACATCAAGCGTCGCGGCCTCACGCTGCGGCGCCGTAGGGTTGGCCACCAGCTGGCCATCCACCTCGACAACACGCACACAACCCACCGGTCCGTT
CCACGGAATGTCGGACATGCCCAGCGCCGCCGACGTTGAGTTGACAGCCACCACGAGCGGGTCGTTGTTCGGGTCGTACGACTGCACCGTGGCCAGCACC
TGCGTATCTTCACAGAAATCGCGCGGGAACAGTGGGCGGATGGCGCGGTCCACCACACGAGACTGCAGCACCTCCTCGTCACTGCCAGTGAACTCGCGGC
GCTTCAGGTTGTCCGGGATGAGGCCTACAGCATACGACTTGACGCGGAAGTCCACCGTGAGCGGCAAGAAGTCCCTTTGCACCACTCCGCCATTGGCCGA
GGGGTTGCCATTGCGGTCACCACTCACGACCGTTGTGAGCAGCACCGTGCGGCCGCACGAGGCCAGCACGGCGCCGTCCGCGAGTTTGGCGAGCTTGCCC
ACAGTGTACAAGGTGTTGTCTAAGCTGCCGACCACCGGCTCCTTCACCTTCTTGGGCTCCGGCGGCTGAGTCTGAGTCTGCTTGGGCTCCAGCTGCTGCT
GCTTGTGCTGGTTCTGCAGCTTGGCGACCTCCTCTTCCTCTGGCGACGGCTTCTTGGCGCCGAACAGCAACTCGCGCAAACCGAAGAACGCGCGCGCCTG
TGGCGCTGCACCAGCGATACGAGGCACGCGTTGGCGAGCTGCAGGGATGGCGGCGCGGCGGGCCACGGCCGCGGCCGGCAGACGACGAGCAGCAGTGGAC
AGCATCTTGGTCAATGTGTGGCTCATGCAGCAATCATTGATTATGCTGTGGTGCACACTAAACCATGTTCTGACACACCACGCGAAACCAGCCAACCGTC
TTTGTTCAGCTATTCGACCAGCACAAAAACTTTCAACATCAAAAACAAAACGCTAGGTTTTTTTAAATCGCAAGGAATTGCACCATCCGTACTGGTCGAA
TAGCTGGTTCCTAGAGAACGAAGTGGACCCACACAATCAAAAAGCTCAGTCCGTCCGCACCAGCAGACCGTACTTGCTCCCCCGCCCTCCCCCCCGTCCT
CCAAGCCTCCAGACTCTTCAGCATGGGCACTCGTGTGTACGTGGGCGGCCTCCCGCGCGACGCCACTTCGCGAGAGATCCAGGACGGCTTCAACCGCTAC
GGCCATGTGTCCAACATTTGGGTGGCGCGTAACCCGCCCGGCTTCGCTTTCGTGGTGAGTTGAGCCCCTTCCCCTGCTGCGCGAGGCCTCGCATGATGGC
CCTGTCCTCCCTCTTTCTTCTACCCCCTCTACCTCTCGGCGGCGACAGTTTTCCAGATCGGCAAGCGGCGGTCGGTGGCAACTTGTGTATGTTTTGTATG
TGGTGTCTAGTACTATACATGTTGGTGTATACGCTACCGCCGCTGCTTCCATCCGGCCCTCGGTGTAAGATGATTGTTGTCCGTCTGCTGCCCGCCGTCT
TCGGTGCTTCCTTCCACTGCCGGAGGGAGAGATAGAGGAGACGTCGCTCTGCCGACGATGGTGGAGCCATCATGCTGCGCCTCGCCTCGCCTCGCGTCTA
TCGCCATCTTCATCTTCGCCTGCAACGAACCAATACCAACCAACGCCTCTCCATCGTCGTCCTCCCCCATGCTGCTGCTCCCCACCTCTACTCTAGGACT
TCGAGGACCCGCGTGACGCTGACGACGCCATTCGCTCCATGGACGGCCGTGACTTCCTCGGCGGACGGTACGCGCTGCTGGGTTAAAGCGACTGTAGTCT
ACAATACATCTAACTCTTGTGCTGTGAGCAGCATTCGTGTCGAGCTTGCTCGTGGTGGCAGCCGCCGTGATGGTGGAGGTCGCGATGGTGGCGGTCGTGA
TGGCGGTGGCCGTCGCGGTGGCGACGACGACCGTGGAGGAAACTTTGGTGGCGGTCGCGACCGTTTTGAGCGTGGTTAGTATACGCTCCAGCCAGTGTCG
TTCTCGTTGGTGGACTGATCAAACGTGTTGCTGTGTGAACAGGCCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTGA
TGTGGACTGGCGCAACGTTAAGGACTTCCTGCGCACGGGTGGCGAGGTTACCTACTGTAACATCGAGGCCGATGGCTCTGCGTATGTATAACAAACCTTG
GTGGGCTGATATGCTTCTGATCCAGTTACTAATTCTTGTGTTATTTCTTTCGATGCAGTATTGCTGAATTCCAGTCCAAGCAAGACTTGGACGACGCCAT
TAAGAAGCTGGACGACACGGAGTTCCGTGGCAGCTATGTGCGCGTCGCTGCTGAAGGTGGAGACTCTGCCCGCCGCTCACGCTCTCGTTCACCTGCTCGT
GGCCGCTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGTTGCCCGTAAGGACTCCCCTCGTCGCTCGCGCTCCAGATCAGCGTCGCCTGCCGCTGCCC
ACTCGCCCTCTCCTCGTAAGGAATCGGCTTAAGCTGATGTGGATCGAAGAAGGCTGCAGATCTGCATTGGTGCGTACGCTACGCGGTGAGAGCCGTGAAG
GTCTTTGCTCGCTCACGTGTACAGTGGCTGGCAGCTCGACCAGCTTTGTTTGTTGCCTAGCGTCCCAAGGAAAACAAGCACATTAAACGATGGCAATAGC
TTCCTCTTATCATTTTACCCTAGTGTTAACTCTGTTCTCTAGCGTGCAAATCAATTCGCTGAGTGTCAAAGCCACATACAAAACCAACCTCACCAACCAA
GACTCATTCAATTTTCATGACTGCCTGTAGAGTCCTCAGTGTTAACTCCCAACATCGTCAATGTTGGGAGTTACTGAACTCTCTCCGGTATCTTGATTTC
TAGGATGTCCTGTGAGCTGCACGCTGTTCTCTCCCAGCACATGAAACCTGTCAACATCATGGCAATCAAAGCCGAGAAAGCGACGCCGAACGACAACAAG
AAGAGGGAGACCTGCTGATGAAGGTGATGGTATTTGTGACTCCTGTTGCTTTCCTCTGCTTCCACCCCGTGAGCGGACTGCAGCGGGAAGCTGTTACGAG
AGACACCCCTGCCGTGCTCTGCAGGCCAGTCCTCTGCTGATCTCCTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGAG
CTTTATTATGCGCCGCACTTGCACGTTGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTAGTTATGAGAGATTCATCGTAAGTCAAAGATTCCTGA
TGCCGTGGAAGGGAGCTTTCGATTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTACAGGTACTT
GGAGCAACGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGGGCATCTTTTCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTCG
GTGATCTGCTTCGGCTGTGGACAACGCAAAGCACACACATCGGACTGTCGTTAGCGGGCTGCGGGTCCATCTCCCTAGCTATCGCCGCATATCGAGACGC
CTCCGTACCATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAGCACTAGCACAGTCAACACCAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCA
CGCGCCTTTGGTTGGCCAGCAGTCTCCTTCCGTAAAAACTATTTACGCTATCGACGCGTAATTACACCCTATTCGTAACCCCTGATGAGGTACGTCGTAA
CTTGTATGTGGCGCACACCACTCGCCGGCACGTTTTTAAACAGAGCGCTACACTTCATCTCACTATGGACGTTTATTTCCTCAGTTGGAAACGTCCATCG
GAGCAGCTCCAGAGTCGAAGATGGCGTCCAACCAGGAATGCCACATCTGCCTGGAGGAGCTGCGTCAAGACCTGGTGGCCGCGCCGTGTGGCCACGTCTT
CCACCACATATGCATCTTGCAGGCGCTGCAGGTGAACACCCAGTGCCCCATCTGCCGCCGCCGTGCGGGCGACGCGGACCTCATCACGCTCTACTTCGAT
GTACCGGGCGATAATGAGGCACCCGTCAGTGAACTGCAGCCGCTAAAGGCCTCGGGGGACAATGTGGAGCTCAGTTCGCGCGTCAACGCACTGATGGAGC
GCATCCAGTGGCAGAACAAGCAGCGCGAAGGCATTTTAGGCGAACTGCAGAGGGTACGCAGCCAGAGTAACCAGTTACTAGCCGACAAGCAGGCTCTCGC
ACAGCGCGTCGGAGCGCTGGAAGGAGCCAAAGTGGAGCTACTGACGAAAGTGGCGAGGTTCCAGATGGAGCTGAGTCGCCAAACGGAAGCTGCAAGGCGC
TCCAGTGTGAACCAGAGCATTGTTAGGTACCTGGAGACGTGCGACGCAACGGCTATGGAGGAGGAAATCCAGAACCCCAGGGAGCTAATTATGGCGCTGA
AGAAGGCGTGCAAGTTCCGTCATGACCAGTATCAGAAGGTGGTGAAAGAGAAGATGAGGCTCAAAGAGATGCTGAAGAACTCCCAGCCGCAACCGACAGA
GCATACAGGGAATAGTGCAAGGTCGGGTAAAGCCAAGGTTCGAACAGCGTTCGAGACCAAGCGTGCATATCCAGCAGCAGGTAACGACGGAATGGCGTTC
GGAATTGGCGGCCAGCCGCAGTTGGTGGAGAACAAGAAAAGGAAAATCGACTCGGCGTCAGTGGCATCGAATCCAATGCCACTCATTGACAATGACGATG
ATGTGGGTTTCACACCGCGCTCTGAGTCGGCGGGCTTCCGCGCAAACGCCTACTCGGACGTATCGATCCGTCCGCCTCCGAGTTCACGGCAAACGTTTGG
GCGCAGTAGCTTCAATCCGAACCAGTACGGAGCTTTCAACCTGTCGCCAGCAAGCCAGCCACCCGTGCAGATGGCAGGACTCCAGGCTGCGGTGTGTCGT
CGTGGCTATGATGAAACTGGAAAGCTCACCAACTTTTTCCTTCCATTGGGAAAGGAGAGTGATTCACGGTCCATGCCTCGGACGAAACCCATTCCGAGCA
TGCAAAACCTGCTGAACGCACAAACAAGAACTTCGGGTCAGCAGCAGCGCATGGCGAGCAACGACCGACAGGAATACGCACTAACAAACTGGCTGCGCAA
TAACTGAAGGAGCCGAGGGGAAAGCCCGAGGTCGCAAGAAGGCTCTGAAATTTGCGGTCAGAAAGCTGTGTACAATACGATACTATTTGCAATGTTAGCG
GCCGACGATTGTCGTTCGCCCTTTAAACTTTAAGATATTTTGCTTTTGCTTTAGCGCTTTTCTTGAGAGCTATGGAGTTGGAAACGGAGGTTTGTCAGTG
TTGCTTGCAACGTGGCTTGATGTTCCTTGATAATGTTGATGACCTCAGCGTCTTGGGTTGGGAATTTCTTACCGGAAATTAGACGACGGCAAATTTCCTC
GATAGATAAAAACGAAGTGTCTGGGTTGCTGCATTCCACTTCTACTGATTCAGGTTCAGCTAGTGCTGGGTCAGCGTCGGCCATAGCGGTAGAAGGTTGC
CCAATACTTTCATCTGGCTCACCGACTTTGTCGCTTGCATTTTGCCGTGAAATTGCCACAGTTTTCGATCGCCTCCTTCCAAGAAATGAGAATTCTACTG
GCTCCGGAGGTTGTGGCAAAGGCGAAAGCTGCTTGCAGACATAGTAAAGAAGCGTCGCTAAGTTGGCCAAATTCGCTGATGCCTGCTTGCCAATGCTCTT
GGGGCCAATACCAACATTCCAAGGCTGCAAGATGACATGCGGGATCAGGATCCGCACAAGCAGAAAATTGATCACCACTACGTTGAAGCGCAACAGACTA
CCACTTTCAACGGAAACCATTTCCCCACTGCGACCATGCTCATCTGAATCAAGAAGGCTGGTTCCATCAAAATCCATTCTCCTGGTAGCACCGAGGGGGT
CAAATTCGAGACTGCGCCGCTCTTCGTCAAATAGTTGGTACTGGATCGAAGTACATCAGGATCATGGTCAGGTCTGCCAACAACTACAGTGATTGAAGTT
ACTCAACGTACGCTAGGCGGGAAGTAAACGCCATCCGTAGAAATCCGCTTCCAGAAGTCCATGATGCCAAAAGGGACCTCCTTCTTATCGATCGCTTTGC
CCAGTGATTGCAATACTCCTCTCATGTGCACTTTCAGCTTTAACAACTTCGCTGGATCCACAGCACTATCAATTGGATGCCCGTTACCCGCGAGAGGTAG
CGCTGGTACAGGGGGGCGACGAGCAAGGATGCCACCAAATTTCTTGGCAAAACCTCGCAAACTTGACCCCGCAAGACCATTTTTCGTGCTGATGTCCACG
TCTACACTTGGATCCTGAATCAGTGAAAGCAATGGAGTTCTTACCACCTTTCCAAGCCACATGCGAGTGGCGTCAAAGTACACACGTAGCATCGCCTCAA
AGTCCTGAGCAGATTTCGTCAGAGGAAGAGTGAGATGTTAAAACCTTAAACGGTATGTGTTGTGAGCATACCCGGATTGCGCTCTCCTTTTCAGCCATTT
TCTTGTTCATCAACAATTTTTTTAGACACAATGTGTACATGACAGCACGTACAGCGGATCGGAAGATTTGAAGAGGTTCCATCGCTTCAGCATCTTGGAA
CCCGAAGGGTGACACCTCATCGCTTTCAGCTTCAGACTCTAGACGCCAGCGTGGTTTTCGTAGAGCGCCGCTGCTTGCGTTTTTAAGAGAAGCATTTAGC
AGTGCCTCCAATCTCTTACGGCTCTCAAGGCGCTCTCGTGCTTTTTGCTCGTTTGAGGTGCTGGTGTTCGCACTCACTGTGTTTGCAGTTGCATCACTTT
CCTTTGCATTGTTACTGCTACCAACCACATCACTTCCTGTAGCGATATCCTCATCGTTTTCAAGTTTACCCAGGGTCTAAGCAAAAAGTGGTTAGTATGG
TGAGCAAGAGGCAATTGGATCAGAGGCGCACCATTTCATCTTCATCCGTCCATTCAAACTCGGGAAGCCATGACAGAGGAGATGGAGTTTGCAACGTTGA
AGAAACTTTCCTACTTAGAGATGCGCTGTGTGATTCTGGCTGTATTGTTGGGGTAGATGGCTCCTGCGCGTCAGTAAACTGCATCCATTTAGTCTGTGCG
TTAGCGTTTTCCTTTGTGGGGGAATTAGGAGACAGTGGCGGTTTGAATGGTCTCTCCGTGCTCAAAACATTATCAGCATCACTTCCACGCATTAAACCCA
ACAAATCAGCAAGTCATGATAAGCATTACGCACAGTAGAAGAAATGAACATATACACGTACTGCCTTCGCGGAAGTAACAGTGCCATGATCTGTTCGTTT
TGGTGCACCAGTCTCTCAATAAGGCGCTCACTTGACTCGGGGAAGCGCTGATCAAATCGTGTTATAGGTGATGTTTCGAGTGCCCCTCCAAAACCGAGAC
GAGGAGAACCTCTTTGTACTGGATTACGTGTAGATGCCTTGAGCTTGAAATCAGCAGTTTATTGAGCACAACAGACCTTCAACACATGCAAGACTGTGTC
AAGCTGTCCTCACCTCATACTGGTCAACCTGCATCTCAAGCCGCTTCACTTGAGCTCTGTCGAACATGTCAACACGACAATATCTTGCCTCAGATAAAAT
TCTGTGCCAGATACGATAAGCAAAGCCAGAATCAGTACCTCAACTCTTCCCGGCGTTCTTTGCGAGCCGCGATGAGTTGTTGCTGACGCATTCGCAGCAA
TTCATCCTTTACCCCCTCTTGACGAAGAGAAAGTGCCATGCATTGTGGCGCAACTTGATGTAGCGAGTACATGTCACTCCTTGGTCCGGCGTGGGGCATG
CCCACGAAATCGGGAGTTGTCTGTCTTTTTTTGGATGCATCATAAATGGCTCATAGACAGACAACTCAACTCGTGAACGATCAGACGTGAGACGAACAGC
GAAATCTGTGTATTTCTCCGCTGGAATGTTTCTTGATCAACTCTCCGCTGTCACTTGGTCCTGCTTATCAAGAGTATCAGTAGTGACAGGTTTGTCAGCT
TCAGTGGCATTCTTCTGCTCCTCCTTCTGTTTGCCATTGGCTTCTTGTTTTGCGATCTCCTTGCGTGCCGCTTCTTCTCGCCCGAGAAAATCGTTAGTCA
AAGACTGCTGCAAGTCCTCGATTTCGTGGAAGACCTCCAGTGATTTCTCCAGGATCAGCGTAGCAGACTCCAGCGTGTTCTTTGATGCCTCTAAAGTCAT
GTTGGTAAACAACGTGTTTGCTTTGAAAGAACCTTTCGCCATCGTTGCCTGGACACCACGGATCTGGAACATGAATGCGGCAGACAAATGGGGTGCATGT
AAATACAAATAGTGTAGCAGGGCAAAGAGCAAGCAGCATATCGACATCTAATGCTGTTACCTGATCTGACAAATCCCGCACTCGCTTTGAGATATCCCCG
TAGCGGCATTTCATCTTGCCACAAATCACAGGCAGCGAAGCCTCCGCATCACTGATGTCCACCACGCCGGGAGTATGAATTCCTTGCGCTGCAACACGAT
CTTCCTCCGGAACAAAGGTAAGCAGCGACGCCTTGAACGTGCACATGCCCGTTTTCTTCAGTCCATACAACTTCGTGTCCGATTCCGGATTGCTGGAAGG
AATAAGCTCCACAGTCATGGAGTAGTGATCGTTGTCCATACACTCGTCTCCGTCGTCATAGATCATGTATTTGTAATTCATCGTGATTGGATCAATGTGC
CAGCCGCGGAAAATCCTACAAACACATGGAGCATTCAATCAGCGCTTCTCCTTCCATTTGCCAATGACCTTCAAGTCTACCTTACCCGAGAATAGTGGGA
ATTTCCGGTTTCTCTTTCTCCTCTGACACTGGTTCTTCCAGCTTCGCAGATGAATCTCCGTCCTCAGTCGTGTCCGGCACGTCCGCAACCACTTCCACCT
CCACCTCGACTTTCTCCTCAATCTTGGCCTGGATTGTCACATTTGCTAGGTGGCAGAAATCTAGAGTATAGCTGCAATAGCGTTAGATGGGTTGGAGTCT
CTTGTAAAATAGCGTTGCGAAGAGCGTTCTGCCTACGCTTTGCCCTGCTGCATCTCCCTCTCCTCGCGAACGCACGGCAGCGACTCGAGTTCATCAACAA
ATGGTCCTGCCTCACGTAACATAAGAGGAAGGACGCACTACACGTTAGATATTTTACATTATTTCACACTTCGTCGCATCGCAGACTCGCCTTGGAATGC
GGGAAGTGGATCGCGGGACGGCACCGGCAGCAGCACTTGCGGCACCTCCTCTTCTGGGCGCGGGCGCGGGACAATCCGGATGTCGACCTTGGGCGCTCCT
GTGCACAGCGTGCTGCTTAACGCCACGACGGCCATCGCACCGGCGAACACGCTCCTGCCCCGCATACTCGTCGCTAGCTTGGCAATAATTGCAATAAATG
TGTTTTCGCAGGGTTACTTCGTATGTTACATTTCGTCGGGTATGTTATGATACAGGTTGTATAACTATTGACGGGGATTTCGCGAGTTGAAGATGTGGAG
TGATGGTCATCAAGCTTCGTGCGGAATGCGCCGCTCAGTGCGGAATTTGCCGTGTCGTGAGCAAGCGACCGAGTGAAGATGCAGGAAGACGGCGCCGCGG
CGATTATGAGCGGCGTGCACCGGGCGATAGAGCTCCTCGCCCGCGCTGCAGAAGGCTTGACGGCTTCATATGACAGTCACCAAGTTTCCTCGACGGATAT
TGATGCCTTGAAGCAAGTACTCGAAGAGCTTCAACGCCTCATCCTCGAAGTTGGATCGCAGCGTGTACTGGAGCTGTCGGGGGCGCAGTTGATGAACGCT
GGCGTAGAGTTGTACAACGCGCCTCGAGCTGCTCTTCGAGCTCTTGAGCAAGTAGAGAAATCCAAGACGAAAACCGACTCAGAAGCTACGAGCTTACCAC
GGTATTTGTTAGCGGTCACGCGATTTGTAGCTGCGAAGGTCATGGAACTCTCATTGGTTTGCTCCAAGAACGGCGGTGGTCAGGAAAATGGAGCGAGGAG
AAACACGCAGTTCATGGATGAGTGTGTCGACGTGCTGCGCTCGTTTGGACGAGTGGGAATGTTCTTGTTGGAGAGCGCATCAGTTGACTGTGAAAACTGC
GAAGCGTATTTGGAGCTGGCAAATGAGGCCTTTTCTTCTTCGATGAAGCTCTGGTCTCGTATTGGCCTCGCTCATTTGACAAAATTTAAGCAAGGCGTGG
AGCTGGACGATGTTGTGGATGATTTGTGGGACTTTTGTACCCATCACGTACGCGTGCTCCAGCTGATTTCACAGCGGCCTGACAATTCAGCAGGAGAGGC
TCGAGATATTGTGTCATTGCTGAATGAGTTGAAGATGCTCGCTCCGTACAAACCTTCGTATGCCAGCAGCTTGCTTGATCTCATGCGCAGTGTTAGTGAT
GAATACAGTCAAACAGCGCAACACGAACTGCAGGTGGTTTTTGCCGAGGAAGCGCTGCGTGTGAGTGAATCGCTTGAAAATGATGCAGACGAAAACTTTT
CGGAGCTGGTTACGTCGTTCAAACAGCATGTGTTGCTGAATTTGATGCAATCTCTCTGCGCTAATAATGACATCGAGCGAGCAGAAGCGTGTTACCAACT
CATTCCAGTTAATCGGAACTCCAAGGTCCTTCTACCCATGATTAAGCTCTACGTCGACAACGAACATTTTGATAAAGCACATCGCCTACTGCTGTCGTTG
TTTCAACAAGACAACTTTGACGATTCCATCTTGGGAGCACGCACATACGCCCAGGGGCTGTCTTTCTCGATCAAAGGAATGGATATTTATCGACACCTAG
CCATAAACTACGGGGATTGCGCGCATGCCATCAATGTGGAGATCGCATGCAATCTTGCTGTGGAAGAGAGCAACCGATACCGAGCGATGTCAGAACTCAA
ACGCATTGGCCTCGAATTGCTCGAGATGGAACGGTAAGAAACCATTGGGTAATCAGACCGGAATATAACGTCTCACTTTTAATTGCATATTACAGCCTAG
GTGAAAGTGGTGATAACAGACTTGTCCAGCGGGTTCAACAAACCATTTTTGATGCTCTTCAACTCGCACTTAATTCCAACCAACACGAGGTAACGAATCA
ATAATGGTGTGCAGCGCGGCCAAATCGACTCAGTTTCCAGCTTGTAGGACTGTTTGAAGTGGGCGGATGCGGGATTGGCTTCGGCGTCATCAGCTGATGA
TAAAGCGACGTACATGAGGTAACATTGATTTAGAATGCGTGACCACTACATCAAACATTGATGAAAGTAATGCTCTGTAGGACGATGTCGCGTTCTTGCC
TCCAGTTGGAACGCTATACTGAAGCTGGGGAGTGGGCAGAGAAGGCGTTTGCTGAAGAGCCTTCTAAGCAATCTCTATTCACTGTTTTCCAAGTGGCTCT
ACAAACAAAATCGAGTGCCTCAAATGAAGAGCTGGTTCACATTATGGAGCAACTAAAAGGCAGGGATGATTTTGAGATCGAAGATTTCCTCGCCATGGGA
AAGCTGGCTGATGATCTTAGCCCAGCAAGACAAGATATCGTGATGCACGTTCTCGACGAGATTTGTCGCACGATGATGCAAACTGAGGACTGCCCAGCTA
ATCTGCCCAAGGAAGTCATCCTACAAAATGCAGCGCAGCTAGCATTCAGCACGTTCGCTCAGCGGCAGACTGAGCCAAGCCCTGCTTCAAGTATAATTTC
CTATGGTGAGAAGTTCCTGGTTTATGCCTCTGCATTGCTGCAGTCATCAAGACCGGGTAGCATCGGCAATTTAGGGCCTTCTTCAGTGTTTGAGTGGTTC
TATCGAATGAGGTATGACTCAGGATTTCTTTTTACGAGTTGGAATTGCAAACTCACAGTGGTTTCTTGATGACAGCTTTGACATCGCCAAAACCACCGGA
GACGCCAAGTTCTTTATCGTGGCAGCAGACATTGCACAACGCAGCGACGAGCTGTACGGAGAACAATCCCCACTCAAGCAGCGATGCCAGCTAAGTTTGC
TGGCAACGGTGAGCTCTGACATGAAAAATATAGAGACACTGGGCAAGAGTCAACTCTTGCGGCTTCTTGAAGTGATCGGTCGATTTGAAAGTATCGCTTG
TGGGGACATGTACGCCAGTGCTGATGTGAAGATCTACTTGGTACGAAGTATGTTTTTATGCTTGTAGCAAGAGAAATGCTGTTCACCCTGATGATTTCTT
GTCGACAGGCAAAGTCAGTGATAGCGGTGAAATTGCGGCTCTTTGACGCAAACACGAAAGCAATTCTTGATCTCTGTAAGGCCACAGTGCACAGCGCCAC
TGACCTCATGCAGATTGGAGGTGTGGCAGACGCAGATGATTGCTACCTCTCGCAATTTCGCTTGCACTAACACTGTGTTGAAGATCTAGTGCTGTATGCT
ACAAAGTTCAACGAAGCATCTGAAGTACGGTTTTTTCGGGCTCAACCTGTAGACAATTACACTCACACGGCTTACTTGAGCAGATTCGAAGCAGCTATCG
ATCACTTGCCAGCGAAATATCCAGCTTCGGGTACCGGCTATAATGTGTTCATTCAGCCATGCTATTGAACACAAATTGCTCACCCGAATAACGTATATCG
ATCAAAATGCAGGCTCCAAATGCTGGTCCAAGAGGATTCCATTGACGCGAACAAGCTGTGCTATCTGCTCCGACGGCTCATAACGCTAGCTGAATCGAAG
ACAAAAGCATACGAGTGCTTCGACCAACTGATTCAGTTCATAGACACTTTGGACGTCCCGCTCACTGAAGTCGACATGGAGTGGTTTGTTGTCAAAGCGT
GGAACATCGTAAGTGAGCTTGTTGATCTCGTCCAAAAGAAGTTGTACTTCGAAGTACTAACCTACGCAATATTTGTAGGGTGTGTCCTGCCATCGCAGCA
ATGACGCAGAAGGAGCCCTCCGGTTTACAAGGACTGCTCAGACCATAATGCGTAGGCAGATACACATGAATTTTGGCCATCCAAATTGCAGGCTAACTCG
TGTTCGTTGATTATGTGCAGAGCACAGCGAGTCCCTCGTTGGAAGGTTGGGCAACAACCTAGACGCACAATACCAAACAATGCTACGAATGAGTTCCCTA
CCAAAGATTGGCGGGTAGTCAGCGCGTAGCGCCCTAGCGCCCAACAGGATAGCGACTTTATCGACCGAGGCAAACAGCGTACAATTTACTTCCCCATTGC
TTATGCCTCGTACACGTCAGGCGGAGAGCCATGACTCGATACTCCACCCATGTGCGTCTTTATAGCCTCCATGTAGGTTCGCAGTGTAGGTAGGTCTGTC
GTTTCTTCTTTCTTTAAGACCTTCGAGGCCCACTTGCGCTCTGCATACTCACAAATCTGGAAAAACAAACGTAAGCGACAAGTTCGCAAGGTCAGCGTTC
ACAGTGAGTTCTACAAAACTGGAAAATGATAAAGAGTTAAACCCACCTCTTTGATATCTCGGCACGAATGCTGCGGTGAGACAGTGGCCAGCTGCGAGAG
CTCCTCGCCGGAGAGTTGCTTAGCATAACTGCATAGAATAGGGAACACCAATACACTGCTTATAAGTTGTCTGCCAAACCACAACTTCTTCAGTGCAGAA
GCTTACCGAGAAAACACCGCGCGGCGGGTCTTCTCGTCAGGAAGGTTGTAGCGAATGCAGAGATCAAAGCGACTGATCAATGCGGCATCCAAATCCTGCT
TTCTGCAGCATAAAACAGCAATTACGTTTACAGTTTAGCAACCTCCCGATGCACAGAAGGCATCATCTGAAATTTAACAATGCATATACCGGTTCGTAGC
GCACACAACCGTAGTCTTCTTAGCAGATGCAAAACCTTCCACTTTTTGCAGTAGAACCGACAAAATTCGACGCGAAGCCTCGTGCATTGTGCCACCAGAA
CGGTCTCCGGCAAGGGCGTCAATCTATTGCAGACAGCAATTCATAAAGTATCAGTAATGTTAACGCTGTACTTCAAAGTACACCAATAGACAACCAATGG
GGACACGCACCTCGTCAATGAAAATAATGGCGCCATCGAGTTTCTCGCACGCGTCAAAGATCGCAGACATCTTTTTTTCGCTGTCGCCGTACCACTTGGA
CACCACACTCTCAATTGGGATATGTATCATTGGAATTCCAGCCTGCTGTGCGATGATACGAGCACTCAATGTTTTGCCAGTGCCCGGAGGGCCTTCAAAT
AAAACAGCGCGTGGACGATTGCTTTCGTAGCGGCAACGGGTTTTCTGCGCAATGCGCTCGTAAAGTTCTGGGTTCTGAAGCGCCAGCACAACCGTGTCTT
CGATCTCGAGCTTCACGTCTTCGTATCCAGCCTAACCATACAGAAACATAACCAAGAGTCATAATTGGTAAAGCGCTACTGCTGTTTACCCCTTTTCAAC
AAATGCATACCAGACTCTCCCAGGTTAAACCGATTTCGCTTTCTGTTGGCTCGAAGACATCAATACCTAGCCCTTGAAGCTGCTGGATTGCTTCCTCCTG
CAACCAAAGCGCACCATGTGAGTTACTCAAAGTAGGACTACTAGCAAAAACAACAAGCCAACAACGGACCTTGCTGCCAGGGGTTGCTGTTGTAGCTGTG
GTCGGATTTCTTCCACGTCCAACAAGTGCGTTCCTACGCCGCTGCTCAAGGTCATGACGGAAGAAGGCGTTCACGTTCGCGTACGAGTAAATCTCCTTGT
AGGCACCAACAATAGCGTCGATCTCGCCTTGCGTGAGAAATTCATCCTTGTAGAAAACAAACTTGGATGTCGCTTGCAATGAAGACGAATCACGCAAGAA
CTGGAACGAACCAGAGCCGTTCGTGTACAAGTACGTCACAGCAGGCTGTTCGTAGGCCTCCACCACCGACTTCTTCGCGGTGTTATCTAGCGGCATCACC
TCTACCGACTGCTTGGAGGCAGGCGTCGACGCCTTTTGCAATTGCAGTAAGAAGCGACCAAGGATAGCTTCTTGGTCCACGAACGTCGGACACGCAAACT
CGATCCGGATCGTCGACACGCCGTTGGGCGCGTGGATCTTTGAGATGCCAATCTTCTTGATCGGAAAAGCCTTCGGGATGCGCGTCTCGGAGCTTTTCAG
CGTCGTACGGAACTCCGACACTTGCTGGCGAATGGTATCCACAGCTTCCGCGTACTCAAAGTGCTGCAAACACAGTCACAAATGGAGCATTTAGTCTTCC
TCTCACGATATATCTAATACTTCAATAAAAGGTTCCTCCAACCTTCTCCTGCTTCTTGTCAGGGGCTGCCTCCAATTGTGTCGTGTCCGCATTCACCCCC
ACAACACCAGCGAGAGCTGCAGCAACAGCGAGCACAGCGAATCTATTGGGGCCTGAGTCGCCAAAGGCCGCCACGACGCTCAGAGGCCGCAGCGCTTGGC
TGGAAGGAGCTGCAATGCGACATAGAGAGGCATCCATGGCCACTGGCAGCCGCGTGGACTGGACCACGGCGCGTGCTACGAGCTTGACGGCGAGCCCTCG
CTGCATCCTTTTGTCTCGGATTCTCAAATAGAAGTAAATAGTAATACCTAGGTTTCAGTAAATGCACAAAATTGGGACAAAATGCTATGTTCGAATTGAG
TTTAACAGTGACTCTGATTAGGAAATCGTGCTGTCATTTTTCTTGCGACTTTATCAATTGATACAGGTCGAAGTGACGATCACATATGTAAGGGATTTTA
CGGGTTTACTCACAGGAGGTGCATGTTGTGCGAGGAAAAGCGATATTTGTATTGAATGAGTGAAGGGAAGCAGCGTCACTATTCGTGACTCACTAATGCT
TGACCATCTAGCGACCACCGCGCACAAACACTTTTTTTGGTGGGGTCTCGGCAGCTTTCTGCTCTTCGCCTTCACACCGCTGTCGGAAGGTGGCAAGCTG
TCGTCTAAGGGTGCTGATCGTCTGGGCTTTCTGGGCAAGAATCTGGCGCACGTAAAGCGTCGTCGTTAGCTCTGTAGACGCCATGGCAAAGCGCTCAGGT
ACCTACCTCTTCCAGACGCGAAACATACTGCTCAATACTCGCCGAGTCGCCAGTAGCGTCGTTTTGAATAGCTGCTAACATGGCACCTTCCTCTGTGAGT
AGCTCTGCATTTTCCTGGACATATCCATCAATAGCGCATTAGGCACGAAATAGCGCAGTTCTGTTGCAGACAAATAAGAGTAACAAACCTGAATTGCATT
CATGTGTGTGCTGAGCAAACCCTCCTGCTCTTCATACAGAGTCTGAACCTGTAGTCATGCACACACTATTGTCAGCGTTGCTGTCCCTTTCAGCACATAC
AAGTTAGGCAACAAGCTTAGCATTACCACTCCCTGCCACGCTTCCTCTGAATATCCGCTTTCCAAGGCAGAACCACTTCTTTTGTCTGCTTGTACAAACA
GATTAGAGCCATGTAGAGGATAATCGCAAAGATAGCAGCGTACCCGAATGGTGCCGACGACTAATGCGGAGAATGCTCAAGTCGTCGCTCAAGTCGCGCG
TGTGATGCGAGGAAATTGTCACTACATCCCTATTCCCACCATCAGCATCGCTCCTGTACTGATCACCACCGCCTTCGAGCATGTCATTATCATCGTCTTC
TTCTTGACATTCCTCTTCCTCCTCTTCTTCTTGCTGATACCCGTCTTCGTCATCAAACTCCTCAGCATCGTCACTCCCATCTTGGTTGGGATACGCGTCG
TCACCGTCAAGATCTGTTTACGGCACAACGTAACCTCAACATTAATGTTCATCCCATGGTAGCGATTCCACGAGTTCACACGCACCCTCTTCAAATTGGA
CGTCTTCGACACCCACAGCATCAGACTCAGTATTCCTCTCATCAAAGGCATCCGCAGAAACACGCTTCTCTTTGACCCGATCAGCATAGCGAAGAGTATT
GATCGTATGGTCCGAGGACGAGGCACACGGCGAGACAGCGGCAATCATCACCGTCCTATCAAACAGAATTCAATCAGTTGCAAAAGCTGGTTGGTGCTGG
ATATCTTCAACACGACTTACTTCGCTTTGGCATTGACAAACGAATCTTTTAATACTTGGGTGAGCTTGCTTGCTCGAAAAGGGATATGAGTGCCTCGACC
ACCACTATCCAGCGCTCTATTCATCACAAAAATGCAACGCAAATGAAAGGATTAGGAGACAAATCTTAACCGGCCGCCATTTATAACGTACCGAAAGCAC
TCCTTCAAGGCCAGCAAGCTTCGATTGATTTCCGCAGACTCCAATCGTCGCTGCCGATTGTGATTCTTTGTATCTTCACCACGCTCACTACCCGCAAGAT
CGATCAATGACAATTTGCCGTGGAGTTGCCCAGTTGCTTTCTCACGAAGATTGATCTGGCAGATGCAGTGTGATCGTGATGAAACATCATTCATCTCCGT
GGCATGCGTCGTGCGAAGACTGTTGCCTTTGCTGATCACTTGCAGCAGCTCCTCAGTATTCTGCGGTTGTACCTCCTCCAAATCCACAATCTGCACTTCG
CCTGCGCCATCTTCACGAATCGTCAGCACCTGTCGATGCAACAAATCCTGGCATCGACCACCATAAATCTCAAAGAAGCTCACGCAAATATCCAAAGGAT
ATCCGCGTCTTGCGAAGTCGTCGGCCTGCGCAAACACATCTGCCGCAATCTGGCTCTGGATGCCTTGCATCGTGTGCGTCTTGCCACTACCCGTTTGTCC
GTATGCAAACACCGTAGCATGGCCTCCGTCATGGAACACAAACTTCACGAGCGGTTGAGCTGTGCACATGTACACACTCTCATTCGTCGCATTCTCATCA
AAAGTCTAAAAACAATAAACAATTATCAAACACCAGTCCACAACCTCCATACCTCACCAAAATGCCCCGTACATGGTCGAAATTGAAGGCGTTGCTGTCC
AGATACTTGGTGATACCGTCCACCTTGAGCTTGCAGTAGTGCACGATGGACATGGGGTTGAGACACGTGACGGCGTCGTAGTCGTGCTTCTTGACCTCTT
TGGCGTTCACCGGCCGCTTGCGCACGCAGATGGTGATCTTGGTGTCCCCCGCCTCAGCGTGTGGCCGGCTGCGGTCCTTGTTCTGCTCCCGGAAGGCCTT
GATCATGCGCTGGAAGTCCACGTCGCCCGGGTGGCCCATCTTCTCGTTTAGTTGGCTCTCCCGCTCGCGCTCACGCTTGGCCGCCGCCATAGCGCGTCGT
CGGTCCTCGCGGTTCTTCTCGATCTCGGCGATGGCCTGCATCGTCGGCTTGGTGCGCGGCGTCGTGGAGGGAGCCCCACGGCCGGCGCCACCGCGCGCAT
TACTCGCTCGCCACGCCATCCGTCGTCGGTTAGAAAAATAATCCACCAGCGTAATTATCAGATCCACACTTCAATTTGGAATCAGAACGTCTCAGAAAAA
GTGACGTTTCTGATTCTAGTTGCATTTCAAAATTGACAACTATGGCAAGGCAGGCGACCTCGTCGACGCAGTTGGAGGCGGCGATCGACGCCGTCGCGAG
CGGCGCCATGTCGCTGCGCGAGGCCGCGCGCAAGTTTGACGTGCCCCGAACTACACTGCAGCGCCGTGTGCAGCGCCGCGCGGCGGAGGTACCCGAGTCG
GAGGAGGCGTCAGAGTCTGCGGCGGTCAAGGCGGAGCCTGTCACAGCTGATTGCAACGCCCAGAGCGACACGAGCGGCGAAGAAGCTGCAGAAAGTTATA
CTGAGGAGCATGGAAATACTGCAGAGCGTGACCAGAGTAATATTACAGGACGCAAGCGACTCGCAGAGCAAATGGAGACACCGAACCAAGGTGGGCAATT
GGGTAGTAAAGCTATATTGGTTTTAGTGGGGTTTGACCGACTTTGCGCGTGGATTTAGGCCCGCGGAAGGTCATCAATTGCAAGATTCGGATGCTGTGTA
CGGCGGCCGGGAGCGCGTTGGATGAGTTGAGCAACAAGATGATCCGGGAGGGCAAGTGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCCATCCC
GCAGTGCATTGTTGATGAGCTACGGTGGGTGGAGGTTGTAATTGAATTTGGGATTTGTTGAAGCTGAGCGTGAGTTTGATTGCAGCGCTAACTCGCATCA
GCGGGATTATTTGCCTGTTGCGGGGCTGCCGGAGTTATGTGACGACATTGCTGCGTGGGGGGCGGATCGATTGCATATTGACTACTCGCGGGATGACGTC
TTGGTGGGGCCTGGAACTAAAGAGCTGCTGTTCGTCCTACAAACGGTGTATTATGGAGACCTACTGCTGCCCAACCCGAGTTGTACGAGTTACGCCCCGC
AAGCAGCTATTGCTGGGAGGTGGGTACTTGAATTGTATGGAGTTTGCGCGTACAGTTAGTGAGGCGCAGTCTAACCTAACTCTGCGTAAAGAAACATGAT
GTGGCTGCCAACTCATGCAGAAGATCACTTCGTGCTGCGTCCAGAAGTGCTTGAAGCGCACTGCTCGAAGGATCCAGGTACGTGCAGCTACAGTTAGCTT
ACATCATAGAGCAATCGGAGTTTGCTGACACGGGATTATTATGTAAACCGTCAGACGCCCCGCGGATTCTCATTTTGAACAGCCCGTCAAACCCAACAGG
GTGCGCTTACCAGGCCGACGAGGTTCGTGGTTCTGCCAAGATTTCAGTAGAGCGACGATAATACCCACCTGACGTTGCTTCGTATGTTGTGTTCATTGAT
CATGGCTGACCAGCTGGAGGCACTAGCAAAAGTCGCTAGGAAGTACCGGATTCTCGTTGTATCTGACGAAATCTACTCGGAGCTGCATCATTCCGGCACA
CATCTGTCGCTCTCCAAGTACTACCCAGAAGGAACCATCGTTTCAGGAGGATTGAGCAAATGGTGCGGCGCTGGAGGTTGGCGCATGGGCTTCTGGTTGT
TTCCGCCAAGTATGGGCTGGTTGCGCAGCAGCATGCTCGTTATGGCGTCCGAGACGTACACGTCAGTTGCATCGCCTATCCAACACGCTGCTCGACGGGC
GTTCGTTCTTGAGTAGGCAGCACGATCCAACATCCTCGCGAGAAAGCGACGCCAGACCCCGATTCTAACATGTTGCCTTGTTCTGCGCTGTAGTTGCGTT
GAGCTGGCATCGTACAAACGCAAGTGCCAGAAGACGCTGCAGCTCATCGGCCGCTGGTTCTCGTACCAGCTGCAGAAGATGGACGTCGAAGTGCAGGTCC
CGGAGGCGGGCTTTTATCTGTTCCCATGCTTCCGCCGACACCGCAAGGCGCTCGCGCTGAGAGGCATCTCGACTGACGAGCAGCTGTGCGCGCAGTTGCT
GCAGGATACGGGCGTGGCCATCTTGCCGGGCTCGGCCTTCGGGCGTGCGTCGGAGGAGCTCTTCGCACGACTGGCGTTCGTGGACTTCAAGGGCGACCTC
GCGCTCTATCTCATAGAGAGCATGGTAAGCAATTCCTTCAATGTGAGCCTTTGCCACCGAAAACTCGACTCACTCACCCCTAACGATATTTTGTGCAGCA
AGATGACCCGTCTTTGGAGGCCATCGAGGGCTTCATTCAGTCGGTCTGCCCCAATCTCGACATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCTTGCG
CGGCCGTCTGCCGCGCCAGCAACGGCCAGCGCCTCAGGCGTCGCCTTCTAACGAGCGAGCAGGTCGTGGGGAAACCGGTGTGCGCTCAATCGGTCGCCAA
CTGCTGCTCGCCGAGGCTGGAATTTTGTCTGGAGGTTGCACGTGAATGGCGCAATGGAGACTCTTGCCAACTCGCCGCTGACGTCACACGAAACCGCGCC
CTGTGACGTGCTGTTTCTTGTCAAACGAGAAGGCATCTTATTCGCAGCATTGCATTGAACCGCTGTCCACGGAAGCCCAGCTGCAGTCGACGGAAGCTCC
GCTGAATTGAAATGAGTTGGTGCCAGTGATGCCACTTTGAGCTTCTGCTCCGGGGCCAGGGCTGGCCACTTCTACATGGCACTGCGCAGCCGATTTGTGG
CGAGAAAGTAGCGCTGCCCGTCCGACCCAACATGGAAGGCCAACACCAACAAAGCCAAGTCCATTCGACCCACCCTGGACGGCCAACACCACCAACAAAT
CCAAGTCGGAGCCATCCACAGGTCCGTGGTGGTTTCGTCCGATCGATTGATTACAGTAGTTCTCGTAAATTACACATACATAGCCTGCAACCCAAGCCTC
GGTACAAAGCCACGAAGAGACGACTGGGGGAAGTTGTCTCGGCATTTCACTTGCTGACTTCTCTCGCCTTCTCGATGCCTGCGGTCGACGAGTACCCGCG
CCGTACGCCGCCCCGGGACGCCGCGGCGCGCTCGCGCTCGGCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGTTCCAGCACCAGGTGCAAGTGAGCGGC
AGCAGCAACCTGCGCGCGTCGTACCAGGAGCCGCAGCCTTCCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAGCGCGCAGATGCGTCACTCGCTCACGC
ACGTGCAGGGCTCAGACGCGCAGCGCTCCAGCGCGTCGTCCACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGTGGCTCCAACTACCTCAATCTGCACAC
TACAGGTCGAGAGTTGAGCCCCCGCCAGCAGCTGCACCCGGAGTACCCGGCCGCGCCCCCCGCGGGCGATGACGTTCTCAAAGTAGAGATCCCGCGGTGG
AAGTCGAAGCTCACGACGGACAGGGCCGACAGACTGCACATCCCAGCAGGAGCCGACAGTGCAGGCAACTCGCCCGTGGCCAGCGGAGCAGGCAGATCTT
CGACGTGGAACGGCAAGGACGGACGAGGCGGACACGGGGGCTCCATGGGGGCGCTGGTGCTCGGACGGGACCGAGATAACGGATCCAAGAAGCGCTATAC
GGTCTTCCAGGTGTACGTGCACTTCCAGTCGGGAGCTGTCCGCGTGTCTGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACGCTGAGGCGGAAA
TACGCAACGGTCGGGAAACTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTGTCGCTGCGTGTGATTGAGCAGCGCCGGGAAGCGATTGAGACGTACA
TGAACGCGGTACTGACCCTGCGACCACGGCCGATTGAGGTCGTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTGGACGACGAAGAAGAGGATGGCAACAG
TACGGACGGACAGGCGCGCGGCGTGGATATGGTGACAGCTCCGAAGCACGTGCAGTCCACGTCCACAGCTCTTGGGACGTCTTCGCGGCTCAGCGCCAGC
AACAGTTTTGCCTCGGAGGACGCAGGGAATCATTCCGTGACGATGCAAGACTTTGAGATCCTGAAAATGCTCGGAAAGGGGTCGTTTGGAAAGGTCTACA
TGGCTCGGGAGCGCGGAGGAGACGGTAAGATCTACGCGATGAAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGCAACCAGGTGGGGCACACGATGATGGA
GCGCCGCATCATGAGCTCCATCGACCATCCTTTCATTGTCGGGCTCAAGTACTCGTTCCAGACCGCCAGCAAGCTCGTGATGGTCTCGGACTATTGCTGC
GGAGGCGAGATCTTCTTCCACCTGAAGAAGTTTCGCTCCTTCTCGGAAGCTATGGTGCGCTTTTACGCCGCGGAGTTGGTGGCCGCCATTGGCCACCTGC
ACGAGCGTGACATCATCTACCGCGACCTCAAGCCCGAGAACATTCTTCTTGACGAGACAGGCCATGTGCGACTTACCGACTTTGGCCTCTCCAAAACAGA
CTGCACGGACTTCACAGGCGCCAAGACGTTTTGCGGCACCCCCGAGTACCTGGCACCCGAAATGCTCATTAGCCGCAAGAAGAAGACGGAGTACGGCAAA
GCCATCGACTGGTGGAGCCTTGGGACCCTCATGTACGAGATGCTCACGGGCTGGCCGCCTTTCTTTGATCGCAATATCGAGCAGATGTGCACCAAGATCA
TGAAGTCACCGCTCAAGTTCCCGGCTCACTTCGGTCTGAGCTCTGAAGTCAAAAGCCTCATTTCGGCACTGCTGGAGCGCGATCCGACGTATCGCATCGG
CTCACGCCCCGGTGCTGGCGTGGAAGACATTAAGAACCACGTGTTCTTCTCTAGCATCGACTGGAAGTTGCTAGAGCAGCGCGGCGTCAAACCCCCGTTC
AAGCCGCGTGTGCGCAGCCCGACGGACATCCAGAACTTTGACCGTGAGTTTACGAAGGAATTGCCTGATCATGGTTTCTTGCAGCAGGATAAACGACTTG
CAGTGTCACCCAAGAACGAGTTCCAGGGATTTTCCTACACTCGAACGGAGGAGCCAGCATCAATGTCACGAGAGTCAAGCAGCAAGCGAGAAAAGCGCAG
GTCAGGGCGCCGGTCGGAGCCGCGCCTTAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGCTGGACGCCGAACTACTCTTCTGGATCTTCGTAGG
GGTGCCTGATTCTCTCTCTCTTGCGTCTTGGGATGGGCCTTGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCAGCAGATCAGCAGTATCCCGAAT
TCGGCCTCGTCGGCCGTGACAGCACGGATTTCGACACTGGTTGTATCTAGAGTACGTGGAGGCCACCGCGCTCGTCGTGTCCAGTACAAGAAGGAGGCAG
CAGGTGGGCACCAGGAGCAAGTACATGTGATGATATTCTGTTTCTAATTAAGACTTGGTACAGGTACGGAGCCGATCCGAGTGGAGTCGTTCGCTGGGAG
ACGTGAAGTACGTTGTAAGAAAATGAATGAACCTAA