Description :
From Genome Similarity Track
Location :
Scaffold_25:1729- 3486
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.39Ribosomal RNA large subunit methyltransferase N

Sequence
1757 bases(100 bases per row)
TGTAAAAATGCCATAAATTATCAATAATTGTGCGCATTTTTTCTAACTGTGCTTCCAAATTGTATAGGTATTTTAACCTAAATGCCATCAAACAAAATTG
TGGATTTTTGTTGTAGCTTTTCGTTTGTGCGCTTTGGACCTCTGCACTTTGTTTATCTTCAAAGATCAGTCGATTGTCCAGGTTTGAGATCTGATTGAAT
GGAGGGGCTAAAGGAGGGGGGGAGGGGTTGCGAGCGCAATCAGCCACTACCAGCGCTCTTCCCAGCGCTCACTCACTCGTTACAGGCCAAAGGCCTGATT
AAGGTTTCGAGACTAAAAAATATCAGCCAGCAGCCTATGATACGCTCCCAAGTTCAAGTACGTACAACATCGCTCTATTTCTCATTCGTACATGCAATGA
CGCCACGAAGCGCAAAGTTCAACCACGGCCGCCTCCTCGTGGTTCCCTCGCTTTTTTAATCACGCCCAGCGAGATGATGACGTTCGAGCCACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGACAGTCGGCGGTAGCACCTGCTTATCTCAGCGGGAGCGCTTTACGGTACGTTGGAGCTCCCCGTTCTCACGCAAGTCC
AGAAAAAGTCACCCTTGAACTAACGCAAGTCCAGAACAAGTCATCGTGGACCACACACAAGTCCAGAAGGCGTCATCCACCCGTGCACCTTTGAATTCGT
GCAGCGTGCGATGCTCCTACAGTATTACGTCATGCCGCCGCAATCTTCAAGATTTTAAAAAGCGCCTTGTGATGCTGCTGCTTGCAGCCAACTTCAAGTT
TGAGCTGGCGCCTTTCCGCCTGTTTTCGCAAACTCAGCCAAGGTTGGTGCAGTCCAACCATGGCCGCCGCCGGACTCGATTTTTTGGGATTGAGAGAAAT
GCACACAAGTCGCTTGGATGCGTGCAGGCGCGTTTTAATAGCATTCGACAGCACACAAGCACCGAGGATGGTGGCATACGACGCTGTCGTGCAGCGGTCT
TGCTTAGCAGAGCCACCCCAAGCATCGGTACCATTAACTTGCCCTTCGGAGATAAAAGCAGCCTTGAAAGCGCACGTGCTTCTTCAGTATTAGTATCCAT
CGCGAGCTAAAAGCCAAAGCCGACTTAGCATGCATCCGTCATTATTTAGGATCTATCAAATCTATTGAGCTATTTACATAGTCCTGTTGTGCACATCTGA
TACAATAAAACACTCGCACAGCACCCATGGCTCACATACGCGGCGCTGTACGACACGAAAGAAAAAAGCAAAGGAAGAGTGAAAGAGGGAAGGTATCTCT
AGTAGCTTACACGTGTGCTCGTGCACGGCGAGCAAAGCCAATGGCGAGGACCACGACGGACGCACCGAGGAGCGCGAGACCGACGCCTTGTTGGTGGNNN
NNNNNNNNNNNNNNNNNNNNGGTCGATAAAGTCGTTCGCAGACTCCAGAAAATTCTTGACGACGGATGTCGACGCCTCTCCTTCAGACGCCGCTTCTTCC
GTTGACACACCCTGTGCTTTCTTCTTTGGACTCGCAATCTTCTTCGCCGTGCGCTTCGTTCCAATGTCCTCAATATCTTTGTGTTGGTGACTGGACCCAC
TTTCTGCCTCACCCTTGCTCTTGAGCGCCAACTGGCCGCATGCGCCGTCGATATCCGTGCCGTGGTTCTCACGAATCGTGGCCTTCAGATTGTATGGGTC
TCTTAGAATACCGTGGAACTCTCGGATGGCTTCTGGGGATGGCGAGCGGAACTGGGC