Description :
From Genome Similarity Track
Location :
Scaffold_101:17289- 20025
Transcript NameFunction/comments
Phyci_174180Hypothetical protein

Sequence
2736 bases(100 bases per row)
tgtggcatggccccttccggattgaggggatgcacgacgacttccgagtcaagctcaagattgatgacgctggttaccgggttaatccctgggtacatgt
cagtcgacttaagccacgtgccctcttcccgaagcgtccagtcggagaggtcgaagtgtccggagacgatgatttcgacgcggccttacttccggaggac
agctgggagccagactcagagcgtgacgagtatgaagtggagaatattctggacctcaggtggtctaaacggacccgaacgtctagacgcactcgagagt
acctcgttaagtggaaagggtacgacgaccccgaatggttgcccgtgtctcagctcagttggggggcattgctgtacgCGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtggactcgtgcaacg
ctgagcacggcgcgtcaccagcgacacacgagcccgcctccgagcaacttcgaggtgcccgtgaccccgggaaagggcacgctgcccttcagcgacgaag
gcgagtcaatggatcccgtcgtcaacgcagtgaatgctgacgccacgggcaaggctcaagccgcgggtaaggaaccggacgacgacgtggacatggaaga
gcagccaggcatggacagcaatcaagagattgctgagacgacgaagtccttcgccggcatgctgactgagctcgagaaaaaggtgcgaagtttgcatcca
tttctgttagatgacgaaatgtatctaaccacaaattcttgggtacttgactcagggtgcgggcacggcctaaccagcgagacagcgcggtctgtgcgga
aggagcccaacacccaatacatgtttacatttggacagggctctaagcattcaaatacacatattggtacaataaagttgtatttacatggtcgactctg
gcacatgtagaacaacaagcacatccaatcacgagacgtgttgttcgatgcgaccaatgtagtcaccatggtccggcgagcgttccggcagactgatgag
gccctcacaattgaatctgccgcgcgagagttactcgcagcagagggagccaatgcacttgcgacctagtctacgggagcagtgggagctgaagaacctg
tggaagggtctactggtgcagtgggagctgaagaacctgcgcaggccagtaacccagcagtgggagctaagaaacgccgacgtgcgggactcgtggatac
gccaccaaggcgcgagccccgcccacgtcgaaaggcgaagaaaccgaagagatactcggactatcagtgcttccaatcaatgttagagcacaacgttgcg
caagacattctagagcacagagtgcctacaccacgatcgctcaaagacgcgttgagtgggcgttatagagagtagttgaaacagcctctggaaattgagt
acgactccttggtcgagaatgggacgtgaaaactcgtacgactgccacctgggcgtaaggcgttgccatggcattgggtactagttgtaaagtataacgc
tgacgggactgtcgagcggttcaaagcacgcctcgtagcagaaggcaaccaccaggggtttggggtagactgtgacgcaccagtggcacgattcgagtca
ctgcgcctagtgctggcgattggaacgatattggactatcatatccatcagacggatgtccatacagcgtttctgaacggcacgatggacggagagcaaa
agatctacatgaggcaatctcacggatttgcgaagcgaggccatgagtgtggtgtaggaaacatcagttttgttgagcacccaagtggaatagtgtacca
aatccgcctaatagcggaatcgacggtactactcggctggatgggtacactgtaccagatagccgagttcattcaccaggctagcgcgatccaggaggcc
cgctaggttggctacgtggacgatagagtaccaagagccaaggcctaacccgcggcgaccggaggaagtgcacggagtccacagccgagtccaggaagga
gctcagccaagaccaaggcaggtttcggctgccggactcggctaGGGTGGTGTAGGAACGCGTGATTTCgtggaacaagataccaagacagccaagaaag
tagcaccgacggtactactcggctggatgggtacactatgtcagtccgccaatctcgccgagctcgcaggcttcacgggcgcattgcggtcgactgacga
ggaatcaagagcaccggagaccaaggacgggtggcgccacgcaagggaaagaggcacgtacggcggccgagtgcggggagcgctgggagacgctcagccg
agttcaaggcagtttccaggccctgagctcggctgaacagtgccaccggccgcacagacgacgcggggcatggtcagaagccgcacaagaggaccaagcg
tgagctcggcgagcccagcagcgctcacccgagtcggcgagacctccacgtcgagctcaccgggttatccagacaagttatccggctccgccgagttcga
ggcgttgtagtgaggttgaagggtcggccgagatcc