Description :
From Genome Similarity Track
Location :
contig_54:17286- 19167
Transcript NameFunction/comments
g10748.t1hypothetical protein

Sequence
1881 bases(100 bases per row)
AAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTC
AATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTT
ACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAACTACTCCTACGCTTCCTCCTAC
ACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACAGTAGCCATCGCCCATGTCGAGCGCACTGAAGATGGTGCAGCCCGCCATG
TTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGTCGCCGGGATGGTTGCTGCGTTCAACAAGTTGAACGCATGTACCATACGTCACTTCCCATTGG
GTTTACGCACGCAAAACGTCGGGGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCGTATTTCGCCGCGAAAAATGCGTCGATCACATCGAC
TTGCTCCTTCGGTAGTGGCCATTGGCGCGTGGTGCAGTATTTGGTGCCCGGCACCAAATCGATCTCGTGCCGCACACCTCGGTCTGGAGGTAACACCGAC
GGTAGGTTATCGCTAACGACATCCGAGAACTTCTTCAAGAGGGGGTAGTACAGATCCGACGGGTTTTTCAAAATGGCTGCGCCATATCGTTTCTGCCTCA
AAGAGGACCTCTCGTTCTCTAACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGATCAAGTCGAGTTCGCGGCGGATCAGGACCATCTCCTCGAG
CTCCCCCGCCTTCAGGGGGCCGGGAAACTCGACATACGAGAGATCTTCGAGTTCCAGTAGCTCTGCTACCGCAGGCAGAATTGCTAACTCCCCGCCGTCC
TTGTACTCGCCCGTGAGCATGTCCAATACCGCTGGTGCGACCACGCTCTGCATTGCGGCGTACTACGCCTGGACGTAGTCCCACTGTAGTTGTACCAGCC
TTAGCGTCTTCCGACGTGGGCGTTTCTGCTCGACCACTCTCGGTTGCGCGAACACCAACTCTAGCAACTTCTCGTGCGTGAGCTGCCGCAGCTCGAACGC
CTTGTATGCCACCCGCCCCGTGGGCAAAGGCGACGTTCTCGTTCTTGAGAGTTCCATGAACCTCATCCTGATGAGTACACAAAAAAATAATACCTTCTCT
CACACGCACCGAAGGCTCATGAGCTCTCGAACGTGTAGAACACGCGATCGGCATAGCCGAAGGCAGTTCAAGTATTTCCGAAGTGCCGTTCGCCGCGTGG
CACACGATGTTCGTGCATAAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGACTCTGTCCGCGAGGGGACTCCCGCGACCGGCACGGATCGC
TACAATCAAGATCTCTCTGAGTATGGAAGCCTCAGAGAGCAGGCTGCCGTCCCGGCAGGACTTCCTCATCTTTCAGATGCCCACTGGGCTACACTGGAGA
AGATGGTTAGTCTCCTGGGCGAGGCAGCGTTTGCTGGATTCCCCAACTTTCCTGCGGAGCAGTAGAGGTCACGCGTGGAACGCTTCGACATCTACGAGTC
GTCGCTGATTGCTCACATAAGTACTGTGGCGCAGGAAGCCGCTCGCACGGCGATGCGAGCTGATGCACAGAGTGTGGCACAGGCGAACCCCTCGGGTCCT
GCTTCATATACAGCGCGACAAGGAACTACGAAGACCGTCAGGATGTCGGTACAGACGTTTGACGGCAAAGAAGCAGTGTAA