Description :
From Genome Similarity Track
Location :
Scaffold_235:17286- 19040
Transcript NameFunction/comments
Phymu_g7272hypothetical protein

Sequence
1754 bases(100 bases per row)
CCGTGGTGAATCCATACAGCTCCGTGTCCAGCACAGCATAGAGcatgcgcttgagctccgaGCGCGAGATGCCCAAGGGCAGGTCCAGTCGATTGAAGCA
AGCATAGCTGCGCACAAACTCGTCGGGAGCGCCCACAATGCCGCGGATCGTGAACAGACACACCTTGCCATCGTAGCTGGTGAGACCTTCAAATCCCACA
AGCGGCACGCGTGAGCAACCCGTAGTAAactgcagaagacggcgcCGGTACTCGTTGGGCATCTCGCGCACGATCTCCCAGAACCACCCGAGCGTTGGCG
ACCGCGCCACGCTCTCGGCCACTGACGTATTCTTCTCCcagtcgtccacgtcgatcTCTGGGGAGCCACACATGAGGTAGTCCAATTCTTCATAGTcgaa
cagcatcaacaacTGTTGCGGAATGACCTCGTAGATGCCCTTGAGGAACACGTAAAGCTGGTCAGCCACACTGCGCAGGAGTAGGTGTTCAAACTTGCGC
TCAAGGTACTCGTTCTTGTTAGCGTCAGTCACCTCAATGTTGCGTCCGTTTGGAATAAGATCGACCGTCATGGTGCGGTCACCTACACGCTCCATCACGC
TGAAGTCCAGATCCAGTGCTTCCACGCCATcattctccagcatccaTGTCATGCTCTTGTAGACCTCCGGGTCAAAGTATTTTACGTCGTCCATGCACAG
TGGTGTGCCCAAGATGAGCTTGAGGAGAGGGACGCACAGATGGAAATTAAGCACCgtgccttccagcagcgcacgCCCCAGTAATCTTCCCGCTCCGTAG
AAATAAACAAGATGCTCCTCGCCGTTGTCGTAGCGGGAGTTTGAGTTCAGGAAAAACGCGCGGTCCTCCCCGTTTGTAGCCTTGAACAAACCCGCTTTTG
GGTTCGTTAGCAGCTCTGTAAGCATCATGAACCACTCGCGATGCAGTCCACCGGCGTCCACGCCGTTCTCCTCTATGAAGTTAATCCGCATCGCTGAGCG
AATATACTTCTCCTCGATGCACCCTAGATGTTCCATCGACTCCTCAAACATGTAGTCTCTGTGAATCGACAGTTTGAGGAACTCGACTTCTGGCGGGACC
AGAAGTGACGCCGTATTTTTCACGAAATGTGCATACTTGGTTGGAAAGTCTTTTGCCGCGAGATCGAGTGTCTCGCGACGGCGCTCGGCGCCTGCTTGTG
TGTCGTCTTCTAGTACTTCTCCAGTCGCACGGGCCGCTGCGTCCCATTTCGTGGCTGGAATGATATCCATGTCGGCTAGATCGTTAAACACCTTTGCCTT
TACCGGTTCCACTACAGCCACCTCGCTCTGCGTCGCAACGGGGCCGTTCACCTGTCCAGGCATCTTGGCGTTCTCATTGGGCTTTACAAACCGAACGACT
TTGCCAACGCGTGCAGGCGCCATAGGCCCACTTCCTTCCTTAACACGGAACCAGAACATGTTCCCCTCCACGTCCAATTTGCGCGCCCATTCCTTGCGCT
TTCTGGCTCGGAGCTGGCGCTCCGTCAAGTGGCGCGGCAATGCACTTGACTTAgtcttggtcttctctttcttctccttccgcCGTCGCTTTCTCCTGTT
TTTACTGTTGGTATCAGGCGTCTCGCCCGTGTCCATGCGTTCCCCACAAATCGAGCAGAAGAGCGCGTCcttgaagttctcgaactcACACACAGAACAC
ACTTCGAAGCCCTTCTCGGCCTCGCGTGTGGCTGTGTCCAGGCGGTGgtcggtg