Description :
From Genome Similarity Track
Location :
Scaffold_8:172856- 179344
Transcript NameFunction/comments
Physo_129523polymerase polyprotein

Sequence
6488 bases(100 bases per row)
GGCGTTCCGTTGGTCGCAGCATCCGATGCAAATTGGTTCACTCCGTCCTAGTCCAGAAAACAAAAGTAGGCGGGGATATTGAGATTGGCGAAGACAGCCT
GGAAGTAACCTTGGTCGTAACCAGGGACCATCAGCGCTAGCATGAGGCAGTCTTGCCCATTCAACTCACGCTGCGTGCATGCCTCCGTCTTTTCGCAGTT
GTCTTTGCATCCCATGGTGCCGTCGGGGCAGAAATCGTCTGCTGGAGGGTAATACTTTGAGTTGGCCTTGAATGACACGACGCTCAGTGCGTTGATGAGG
TCATCGCTAAGCTTGTAGTGTTTCCAAAAATCTGGGAAATAGGGCGGAGAGGCTGACATACAAACTTCTTGGTCGTGTAGACTCCTGAAAGTCCGTAGTA
GCCTACGTTCCCGGCTTGGTAGGACTCGTTGAAGTAAACCCGCAGGTCCGACATTGTACTGGATGTCCAGACTTCCGCGTTGGGGTGCACATACCTGATC
CAACAGACGACATGCGCTCGGTTATGTCCACATCCACGCCACTTTTGCTGAGGGATACTTTGTAGCCACTCTGTGACAGCAAAATGGGTTCATAAATCAT
TTGACTACCAGGCATCAAGGAAGCGTAGGTGAGCGTACCACTTCTTGAGCCATAATTGCCAACACTAGTGTGGCAAGTGCGTGCGTATCCCAGGCACAAA
GGTCCAAAACGAGTGTTCCGTTCACCTGGCCGCGGCTCCTGCCTTGGGCGTCTTGGTCGGCACCGAAGAACACAGCATCAGAGGCCATGCATTGATCTGT
AAACGCTGTTTCGGATGATGTCCTAGGGTCATCTACCTGTACAAAATATATGATTTTGTGAGAGCCAGGATTCGTAACCGGTGACTAGCATCTACCTGCA
ACGTGTTTGGTGCCCCACACGCTTGGGGTTTGGTCGCGACCGTGCTGATGCGGTCGAAAGTCCGGATGGCCGACAGTGTCGAAGCGTAAGACACTGCGCC
GGTGCGTGCCCGACTGGCAGCAACACCTACTTTATTTAGATGAACTAGCGCGGTGTCAACCACCGACTAACTACAAATACACGTGTACGTCGAACGCGCA
CGACTCAGTTCCGTAGTCGCTCCTCTAGCCACTCGGGCGTACGCCCACACGCGCCTGCCCAACTCGTCGCAGCCGTCGAAGAACTCGGAAGCCACGTGCT
TCCTGTTCGTCACTCTGTTGTCGTTCACGCCGCAGCCGTCCCCCGAGGTCGCCGTTAGTGTCCACCGCCGTTCGTCCACCTGTCGTTCGTCCGTTCACCG
CTTGTTGCGCTTGCTGCCAAACGCGCGTTCCTCGGGCCTGCTCGCTGGCCGTCAAAACCCAAAGTGAGCTCCGTCGTGGGACTCGCGGAGTCCAGCGGGC
CCGAAGATCCAGTAGATCCCTCGGTACCGCGCAGCAGATCCTGCCGACCACAATGCCAGCCGGATTCACGTCCCACGCTGCCGTCTACTTCAACGCCGTC
GTACAGCGTGGTTGCGCGCCCACCGTCTCGTCCTTCGCCGTGTCGTCGGCCTCCTTACACGTCGTCCGCATACCCAAGGTCTTCCACGACCCGGGCGTCC
ATGTAGAGTCGTTCGTATTGAGCCACCGACGTCCACCGTGCTCGTGGGCGTCCATCTGCGTCGAGTCATAGCTCACCGTCGCCCGTCAGCCATCGTCGTG
GGTCACTGCACGGACACAGCTCGTACTCGAGCACGTACTGCCCGGCTCCGTTGCGCCGTCGCCTTCTCCGTCGCCCCACCACGAGTCCACGCGTGACGTC
GCGCACACCAGTGTCATCCACTGCTGCTCGCGTTCGTTTCGAGTTTCCAGCTCTCGTCGTTCGCCCAGCTGGCGCCTTCGCTGACCGTACAGCCGCTGCT
GTCTCCGGTTCATCCCGCGTTGGCCGCTGTTCTTCATCGTTGAGCTGCTCGTCAATGTCGCGCGCAATCTGCGCTAGTAGTGCTTCAGGATAATGATAAC
TAATGAGGAAAGACACGTGGGAGATCAACGTCTAAGCCTTCCCTGTCTTATCCTCACGCGTCAGCACGAAGTTGTCGTACCCAGCAGGTTCCACGATCCG
TAGTGGTCCCATCCACTGGTGCACGAACTTCGTGGCGTTCTTGCCACGGGGCGGGTTGTGCATCCAGACCAAATTGCCGGCCTGAAACTGCCGCCTGTTC
CGAGTCTTCCGATTATAGTACCGAGCCTGCCGTTCTTGCTCGCGTCGTCGAGCATGCTCTGCACACTCATGACTCCGTTCCATCGCTTTCACCAGGTTCG
CGTGGTAAGCTGGCAGCTCGCCCGCTTCCGTCACCTCCGTCCGTCTCAGCAGTTCGTTGGGAGCCCTCAGCCGTCGTCCCATCATAAGCTCCTTCGGGCT
CAGTGCCACAGTAGAATGCTTTGCCGAGTTGTAAGAATAAACAGCGAATTTCACCCAAAGATTCCAATCGACTTGTCGTTCGTCTTGCATGAACGTTGCC
ACGCAGTCCTTCCACGAGCGATGAAAGCGCTCCACAAGTCCAACGAGTTGAGGTCGGTACGGTACGGATTGACCTGATGAGCTTGCAGGAGCTGCACTAA
CTCCTCAATCACTTTGCCAGCCAGCTCCGGCGCTCCGTCCGTCAGCAGTTCACGGAATACCCCGAACCGTAACACCACCTCCTGCATAATGAACGTCGCC
ACCGTCTCAGCCGTATGTTCCGTCACGCAGCTCGCCACAGCATACCTCGTTACGTATTCGACGGCGGCGATGACATACCTGTCACCTCCGTCGGCTGCTG
GGAAGGGTCCGGCGACATCGAGCGCCCAACGATCTCCCACCGCACCACCGCGTAAACTTCGTAACGGCGGTATCACTTCATGTGGTTTCGCCTTTCGGGA
CCCGCACTCAGGGCATCCACGCACCCATCGCCTTACTTCTCGGTACAATCCCGGCCACCAGTACAGCTGGGCTACGCGGCCATACGTGTGAGGACCGCGC
AGGTGTCCGCTCCACACACTGCCGTGCATTTCCTTGAAGACAGCCGCCCAAAGTGTCGGTGGCAGCACCACTCTCCGTCCGTTCGGCGTGTCGACCGTCA
CCAGGCCGTACTCGTTCGCGATCGGCATACTGCCGTACTTGCCGTCTGCTACCAGACGCTTCACGAACTTGCTGCGCTGCTGCGCCGTCACCAGTTCGTC
ATCGCTCAGTTGGAGCGTGTAGTCGTCCACAGGGGCGCTCTCCTCGTCGCCGCCCATGCCGTCCGCGCCGCTCGTCACCATCATCACATCGTTCGTCATC
GTGACGGCGCCGTTCGTCGTGCCCTTGGCCGCCGTCGAGTTCATCGTCGTCACCGACGTCTTGCCCGCCGTCTTCGTGTTGGCCGCGCCCTTGGTCGAGG
GCTTCCGCTTCGTCACCGCCGTCAGTGTCGTTCTCGCCGGCGTTGGCGTCACCGCGGGTGCCTTTGCTCTCGTCTCCGCAGTACCTTGGTCAGCAGGTGT
CGTCCTCTGCGTACGTGGCGTACTCGTCGCCGGAGTCCGTGTCGGAGTGGCTGCCGCATGGCGTCCATCGTCTCGCACTGTACGAGCACCTGATACGGCT
GCATCCTGGTCACGTGGGGCAGTTGTCGTCGTCGGAAGCGTGGCTCCTGGTGTCGTCCGGGGCGCCGTAGCCACCGTAGTCGTCGTCGCTCCCGTAGTTT
CCGTGGGTGCGTCTCGCTCAGTACTTTGCGCTGGGCTGCTCGCGTCGTCCGCGTTCGTCACCGTCGTGGCCCAACGCGCGTGCCGCTGCTCGCGTTCGCG
GAGGCGCTCACTGCGTCTCGTTGCAGGTTTCGCCGCCTTCTTCACGCGCTTCCGGCCGGTCGTGGCAGTCACGGTGGTGCCAGCCAGCTGCCTCGCTGTC
TTCACCGGGTGCTGCCGCTCCGTCGTCATTGCCCGTCACCGTCCTCTCGATCATCGTCGTCCGGGTGCCATCCGTCGTGCTCGCTGTCGTGACGTTTGGC
GCTGCCGTAGTATCCGTCGGCGTCGCTTCATCCATCGACAGCCGCGCTACCCCTGCCGCTGCCGTCGTCCTGGCATCTGCTTCGGCCGTGGTGACGGCAC
GCACCATGTCGCCACCCGCCGTCATCTCATCCGTCAGCTGATCTGTCGTCGCTCCCGGCGTCTTGTCCGTCGTCTCGCCCGTCGTCTCGCGTGTCTGACC
CACAGCTGCTGCTGGAACCATATTCCCGTCCGTCAGCATCGTGGTGCCCGGCGTCTTGTCGGTCATCTGGGGCGCCATCCCGCCCGTCGTCCCGTTCGTG
GTGGCTGCCCGGCTTGCCGCACCGCTCGGTGGCGTCGCCGCTGACGCGACCGCCATCATCTCGTCGTTCGTCGTCATTGTGGCGTTAGCTGCTGTCGTCT
CCGCCACTGCAGTGCTTGTCGGCGGAGCTGTCGCCGTTACCTCGCCCGCATTCGTCGTATTATTCGCATCCGTCGTCCTTGGCGTCGTTGGGCGCCGTTG
CTGCCGTCCTACCGCTGCTCTGACGGCTGCAGGTGCCCGGGACAAGGCATCTGCTACTACGTTCGTCGAACCAGGCCGGTACTCAACCTGAAACTCATAT
TCTTGTAGTACTAGTGACCACCGATGCAATCATCCGGCCATGTTCGGTCGAGTCATGAGCCATTTGAGTGCGGCGTGGTCCGTGATGATCGTGAAGGCTC
TGCCGTACAGGTAGGGTCGGAACATCTTCACGGACCAGACCACAGCGAGACATTCGAGCTCAGTGATGGAGTAGTTCGACTCCGCCTTACTGTTCACTTT
ACTGCCATATGCAATCGGCTGCCAGCCGCGTCCGTGATCCTGCATGAGGCAGGCCCCCAGGCCAACCTTACTAGCGTCCGTCACCAGGCGGAAGGGTAGT
TCAAAATTAGAGTAGAGCAGCAAAGGTCGCGTAGTGAGTAACATCTTCACACGTTCGAACGCGAACTCCTGCGCCTCACTCCATTCCCACTGCACGTCCT
TCTTCAACAAGCGAGTCATCGGCTCCACGATCGAGCCGAAGGCTGCAATAAACTTACGGTAGTAACCGGCGAGGTGGACAAACCTCTTTACCTCAGTAGC
GTCCGTAGGTCGTGGGAATTCCCGCACAGATTTCACCAGCCGCTCAGCGGGCTGCACGCCCTGGTCACTCAGATGGTGGCCCAGGTACTCCATTGAAGTC
GTAGCAAAGGTACACTTCTTCAGCTTGAGACTTAGGCCAGCTGCCCTTAATCTCTCGAATACACCCGCTCGTTCAATCACATGCCGTTCGATACCACCCT
TCGTGAAGATAATGATGTCGTCTAAGTACACCAAACAGGTCAGCCATCTCAAACCGCGAAGCACTCCATTCATCAGCCGTTGAAAAGTAGCAGGAGCGTT
GGTAAGGCCGAAAGGCGTTCGTCGAAATCGGTACAACCCTCTCTTCGTCATGAAGGCCGTCTTATCGCGGTCCTCTTCCGCCACACGAATCTGCATCGTA
GGTCAAGGGTCGTGAACAGACGTGCTCCGCCCAAAGACTCTAGCGTTTCATCTATTCGCGGCAACGGGTAGACGTCCTTGCGCGTGACGCTGTTCAGGGC
CCTGTAGTCCACGTAGAACCGCACGGAACCGTCCTTCTTCCGTACGAGTACTACGGGAAAACCCCATGCGCCTTCACCATGCTCGATTACACCTGCCGAC
AGCATAGAGTCGACATTACTATCTACAATAGCGTCTTCCGTCTGTGCTTGGCGTCGTCGGCGCATCATAATGGGAGCAGCGTTCCCAGTATCAATGTGGT
GCTCCACGTTGAGCATCGTTGCAGGCGGACACTCGTCTTGTGCGTTTGCCAGGTCTCGATAGGCACGCAATAGTTTTAGGATGAGCGCACGCGCGCCCGG
CTCCTCCATACCGATGTCCACGTCGTGTTCGTCATCCAAGGGCGTGTCAGCGTCCCCCAGCTCGTCCAACCACGTGTTCACACGCTCCGAGTCCAACTCA
CCATGCATCGCCAAGAGCTCAATGTCTTGATTAATAGGTATCCATACACCTAGCTCCTTTCTGCTCGGCAACTTGATGCGTCCACCGTATGTGTTAATGG
CAGGTATCATCGCCTTCCCGTTCGTCACCTTGGTCACTGCTGACGCGAGCAGCACCGCTCCGTTGTTCACTGTCGGCAGGAACACTCCTTCCTCGCCAAC
CGGTGCTGCAATCGCTACCTCCACTGTCTGCACGGCACGTCGGTGTAGGTTCGTGGCACGGGCCAGCCTCACAGCTGCCGTCGCCGAGTCACTCGTTTCC
GCCGTCGTCATGAACGGAATGACCGCCATGCCGCCGCGCTCATCGTAGCGCACTTCGCCACAGTCGAAGTCCATTGTCGCCCGATGACCCTCGAGGAAGT
CCACGCCCACGAGGAATTCGCTGGTGCACCCCTCGACGATGCATGCGTCGATAGTCACCACTGTGGAGAAGCAGGATCCAAGAAATTG