Description :
From Genome Similarity Track
Location :
Scaffold_140:1728- 8375
Transcript NameFunction/comments
Albla_Nc14081300
Albla_Nc14081310PREDICTEDx3a similar to AGAP001049PA putative
Albla_Nc14081320

Sequence
6647 bases(100 bases per row)
AAAGGCAGTATATGGTATACTACTTTCCATCATCCTCATTTGATGATATCCCGGAGCCAAATTAATAACGCTGGATACCTTGGCATTGTACACTGACTCA
AAAAAGTGTCCGGATGTTTTGCACTTTTTGGTTTCGATGTTAATACTCATGAAAAACAAGTGGAATCAATATAAAACTTGGATATATATTAGACCATTAT
CTCTTGTATATCCTGCCAAGACTTGGCAGGATAAGATGCAATTGTTAAAAAGACAAAAGTGTCTTACTATACCAACCTCATCCGGACAGTTGTTTTGTTG
CATCAGCATATTTCCAGATTTAACTAATGTCGGTACCTATGAATAACAAAGAATGTTCTAGAACATTCTAGAGTATTCTAGAGCATTATAAACATTTGCA
AGTAATAAAAGTAAGCTCATTTCATAATTCACCATCGATTACGAGCATTTATTAAACATGAAGCTCACACCGAAAGACAAAGAAAACAACGGCCTTTTCT
TCCTCAAAACTGACTTTCATACCGTGAAATTGCAACTAGAATTAACATCGGTCGCTGAACAGTTTATGACATTGCCAAAAGAAATGGATTTAAACGACCA
AGCAACAAGGAGGGGGGTCGACAACTAAAGATTCCTGAAGTTATCAAAAGGAACATGATCCGAAATATTATCTCTGGGAGGTGTGATACTGCTGTAAAAG
CCGCGGAAATGCTTCGACATGATTTCAATATTGATGTATCTGCTCAAACAGCTCGGAATGTTTTGAAAGTAGCGGGGTTGCAAGCTAAACACAAGATTAA
ACAACCAAGCATTCTGCGAAGAATCAAAAGAAGCGATTGGAATTTTCGAAAATGCATCAGCATTGGACTATTAATGATTGGAATCGCGTTATTTGGTCTG
ATGAATCCAAAATCAATCGCTTTGGATCAGATGGAAGACTTTGGTGTTGGAAATTAAAAGGAGGATAGAAAATCTGAGAGCGTAGAAAGATCGCTCAAAT
TGCTAGTCTAGATGATAGCGCTTTTTTTATATGCATAGTAATCCAATTTGATATTATCAATTTGAGTAGGGTAAAAAAAACATGCTGGTTATGAGTATCA
TACCTTCGACCAATCTTACTATTTTGCGTAAATATCAGCCAACAAAATGCTACCTCTCTGTGGCAATAGCCGCACGTAAGGAAGGTATCATTTTTTTTGA
TCGAGATATTATGTTTCCAAGTCAAGCTACATTTTGCGTTATAGTATGGCCAAGTACAAAATTGGCCACCTCTATAAATTTATTATTTCTATAGTTTAAT
TGATTAACATGAGTTATAAATATAATTAACTAATAGAAACACTTCTTGAGGACGGTAGCCAATGAGAGTGCCCACTGCCGGACACTTAGCGTTTATCAGC
ATTCTCTACTTGCACAATAATCTAAATAATACATCAGATGTGCTCTTTTTCTACAAAAGAAAAACGTCATCACAAAGAACAGCTACGCCACTTTCTCCCT
ACGCTCTTAGAAACTCGTTTTTGTTTGTATTGATTGAGATATCAGCAATCGAAGCCAGACTACAATGTGAATTTCAAAAAGGCACTGTATTGACATTAAT
AACCAATAGAAAGCACTTTGTAAGGACATCAGCCAGTCATGACGTACCTGACATGAAAGTGTTATGTCCATGAGAAAGCTGCTGGGGACGCGGCGATGCG
ATCGGTGCTTGCGTACTGCATACTCTGCTGCTCTGCCAATGAGTCCTTTCTGGTAAACATCCAGGTATCTCTAGGCTTTGCGTGCATGAAGGCGGATCTC
GTTGACGCTAAAATAGGAAGTGCAAGAGGCACGGTTCTGTGGTAAGGTAAAGGACCAGTTTTGTGCACGGTATCACTTCAGTGCACGATGCTGATTACTA
TCCAATAAAATCTGGATACTTCAATTTTAAGCAATTTGATTGGCAGATAAATTTGAACCGGTTTAATCCACGATTCGCTGTGTGCGAATTGATTTTATCG
TTTTAGAGGGATTGTATTTAGAAGGAGTCTTTTCTGCCAGCACAAAAAAAAACGAGAAGAAAGCAGATGGTGGTGCGCCGTGGGCACTACGAGAAGCAAG
AAGTCGTCGATGCTTTAGAGAGAGTGCTCCATGGTGGATCGTACGCCGAGGTTGCGCAGACGTCGACTTTTCCTCTAGCTTCAAGAAGGCGAAGGACCAG
CAAAGCGGGATCCCGATTGGAGGGCTGCGCCACGGCACGAAGCCTGCAATTTCAGCGGACCTGGAGAGCGACCTGGTGGAGTGCATTTCCGCAATGCAGC
GCTTGGGACTACCTATTTAATGCACAGAGATCATGAAGCGTACCACCATGATCTACGACGCGCTGCAAAGGCGCACGAGAGACAGCTAGTCGACACAGCT
CACGTCTGGCTTGTACTCGCGCTTCCTTGGTCGCCATCCGGTGCTCGTGCCGCGCACTGCGCAGAGCATTGGGAGAGTGCGAAACGCTGTGGGAAAGTCG
TCGGTTGACGTGCATTTCAACACGATGGCCAAGCTGCTCATTGAGAAGAGGACCGACTCGTCGCGGGTCTTCAACATGGACGACACTTCGTTTACGCCGA
AGTCCACCAGTAGAACCGTCATTGCCATCAGAGGTTCGACGAATGTATGGAAGCAGGAGATCAAGCCCAACTTCCACATGTCCGTGGTGGCGGCCTTTAG
TGCTTCTGGTATCGCTGTTCCTCCCCTCATCATTCTCCCTGGCGTTCGACTTCTCAAGACAGAGCTCGCAGCGCTCTCAATTGACGGCGTGTGCGTCACA
AGTGTGCCAAAGGGATTCAGCAATGCCTCAATCTTCAAGGAATGGTTGGTGATCTTCTGTACCGTGCTGGAATCCCAGGGGATTCAAAAGCCAGTCATTC
TGAACTTGAATAACTCTTCCACGCATGTGAATACTGGTAAATTCTTCAAAACCTTCTATTATGAATTCTTTCTTATTATCAGGTATAAAGGGTTATTGTT
TTTCAGAGTATGTGAACTTCTGCTGCGACCATGGCATCCTGATGATCGCCTTGCTAGCAACCGCGACGCACCTCTTTCAGCCGCTTGACGTGGCCGTGTT
CAAACCTTTCAAGACAATCGTCCACGAGCGTCTGCAGCTTCAAATGTTTGAAACGGTGGACCCAACGCTGTCGAAACAGAAAGTCATCTTGATTGTGTGC
GACTCATACCGCAGTGCCATCATGAACTACGTGACATTTTAAACTTGGAGATCATGCATAGTACGGGCGAGGAGGAGTGTTAGAATTTGTAAGTTTCAGC
GGTGAGCTGATGACTAGATTTATTTTTGTCACAGATCATGTGCACCCGCACTATCCCGCTTCGCGGGCGGATAAAGCCCAAGGCTCTCATTCGCATGAAT
GTTGAGCACTTAAGCAATGCTGTCGAGGGCTTCCGGAGTACTCGACTCTACCCTCTCTCTCTCGTTCAACTATACAAGCGTCTCGGTGATTATCAAGCCG
GGGGAGTGAAAGGCGACTTTGGTATTGCTCCCTGGATTGTTCGCCGCCCGAATGTGGTCGCTACAGTCCAGAATGCAATCCTCAATCTCCCTCAAGAGCC
TGTTCGCAAGCAGAAGAAGCTTAGAACAACGATCGACATCGCAGGCAGGCTAATTACAAAAAAAAAGCTCGCAGAAGCATCCGACCAGTAGTCGTGCACT
AAACCGGTACGTAGTACAAAGGGCCCAAATTTGACTGATTTTCTCCAACTCGCAGTACTTTGTAAAATAACGCCATGAAGCTGCTACGATGTGAATAAAA
ACTGCCGCTTAAAGGGCTCTAACGTGGTGTTTTTTGATATATCCGATTCGTTTTTGTTACTTTACTGAATAAAATCTCCGAATTGATCGAAAATCGTGCA
CTAAACGGATCGTTTACCTAAGTCCAACCCAGGAAGTTATCGCAGTTCTTCCTGGTATACAGTTTAGCAGATCCCCAAAAGGGTTCGATAAAATTTAGCT
CCCAGTGGAGTTTTGGGTACGAAATGTAGTAGTGGCCTGCTCTAAAAATAAGCTCTTCGAGAATTCCTTTTTGTGCCTGAAAATCAGGTTGGTTTCAGAT
GATTTACCTGTGAATAACTGTCAGTACCATGTTGTGGACAAGCTTTTCATTGAACCTTGGGATTGACGTGCCACAAACCACGTTCATCGAGAGAAACTTT
AAGCCCTTAGGGTTGCCACCGAAATTCTTGATCCGGATGTGATTCAGAAAACACCATATCTTGTATGTGTCCAGCACTCTACGTTGTTTTCCTCTATTTT
AGCTGTTTTGCACCACTGCTTATATGATACAATTGACATGCAGAGCATCCGGTGTGAATGTATTGTGGCTTCTTGCGTTGTCAAATGAAAAGAGGGCTTG
CATTCTCGGAAATTGAGTCTCAAAGATTGGGATCACTTTATCGTGAACTTGTGTGTAGAGATCTTGTGCTGTCCACTAGCCATCATGTTGCACTCCTGAA
TTAATAATTGCACATGCTTCGGCTAGTAGGCCTGTATACTTGTTCCACTTTTCTTCATCAAGTGCCAGACGCCCCGTAACGTATGTTAGGAAATCGCTGA
CATAAACCGATCGCCCCTGAACGTTTTTGCGTAATGGTTGTTCAACAACAGGCATCCCCAGACGTTGGGAGACCATCATGTGCATAAAAGGTGCTCTCGT
CATGAGTCACAAGAATGTTTCGAAGAACGTCTTATTTAGGCCAAATAATCTTTGACTCTTCCAGTTGGTTGTCGCCATCGTTGTTTAGAGGCATGCGAGA
CTCAAATGCTGCCAACTTTTTGAGAATTGCTACCTTGGTGCTCACCACATCTTTTATCTCATGTCCATGCATATATATCTTATGTCCCTTTTCTAACCTT
GCGATAAGTTTTGTCTATGGATTTGAGCCAGCGTTCCGTGATTTTTTCTGAAATCGTTGGCGATGGAGCGTATCCAAGCTGACGGAGTATGTTCAGATTG
ATGTGATTTGTCAGCGCCAGTACATCAATCCTATATTTTCCACGTGGATATTTCTGGATAATTAAAATAATGTCTTTATCCTAGAGATAACTTGGACGTT
TGGCATGCTTGCCTCATTCATAAACATTGCTGCCCAAGCACAAATAGATCGCGCGAGTAAATTCCTCTTCCAGCCCCTTCAGAAATAATTTTACTTGCTT
TTCCACGTTCAAAGTCGGCTTTAGAAGATAGATATAAGATTCTACTGCGTCATTTCGATTTTGTACCGTTTGCGAAGCCTTTCCCTTCTCTTTCATCGCC
TTCAACTTCTCTATTGAAACAGATAATTTTGCTTCAGTCGACTTTGAATTATTCTTATTGCTGTCACTCCTTCGTGGAATCATCTTGCTGCGAATCTTCC
TCTCCTTCATGGTCCTGCTCTGCCATTTGCTTGGTAAAGTATGCCGTCAATGGTTTGGTAGCGACTGCTGCACGTGTAAATGCAGCGTCTTTATCTTTGG
GTGCGTTTTGTTTGACCAATATAGCGTGAAGGCCTGGTGGGATTTTCTTATTTGTAGCGGGCAACTAGGGCAGTATTGAATGCCCTTACAATTTTTTCTG
CAACCTCAAGTGTTACCTTCTTCTCTCATTTGTTTTGTTTGTTCCAGCTGTCTTGCTATCGTTATTTGTACTTTTCCTGCTGTCGTTATTTCTACTTTCC
CTTTACCTATGATTCTTGACATCGGTACTCTTTTCAATGCTATTCATTTTATACAGCATATTTTTTTTCGTTTTTGAGCTGAGGGAACCGTCAAATGCTG
CATTATTTTGATTCGTTTTGAAGGTCGTTTCATTGCTTCAACGTCGCCCGATTGTATCGTGGAAGTAAACGGCCACTCTGAATTTAATAATTAACCAAAA
TTTAGATGTTGAATTAAGACATTTAAACCAATCAAAATCTAAATATTTAGAGAGATCGAATTTGGCCACCCAAAAAAACTTGTTGGTTATAAGTGTCCTG
CAACATATGACTTATAAGCTGGCGTAGACATACATACAGACTCCTCCAATACCGGAAGGCAAATTGTTGTAATATCAGTTGGTCAAATGGAAAATGAATA
TATTTTAGTTCCTTAGCTCACTACTTAGCTAATCTAAGCCTATACCGAAGTTTTTCTATTGTGTTTGTAACATCGTGACTTACGTTCCATTTCCGCGTAA
GAAATGTTCTGATGTTCTCAGATCATTCTTGGGGGATAGAGTGGAAACATCTGGTACTAAACGTTTTGTTTCACAATCGCGACACGAATAAAACAACCAG
CCCTCAGCTTAAATTTCGCTTATCGGAGTAAATGAACTAGAAAAGGTATAACGAAAGAGAGGTTTTTGATTCCACTTGTTTTGAAAAAAATATTGTTTTA
ATGTGAACCATGCTATAAGACATCACTTCTGAAAATGTTCGTGATTTTTTCTTAGCGATTGTATTAAAAACTGAACAAGCCGTTGCTCCATGAATAATGA
TGGAACACAAAATTTTGCGACTCCTTCATTATGTTCGTACAGCCCTTCATCTAACATTCCCGGATGATGCTAGCAGTTAAAGATAGTTCTGCATGTTATC
GATGCCCAAGCCTCTTGTGCCCACCGCTTCGCCACAATGACACTGAC