Description :
From Genome Similarity Track
Location :
Scaffold_2433:1728- 2869
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2433-fgenesh-gene-0.0HECT E3 ubiquitin ligase

Sequence
1141 bases(100 bases per row)
AGGATACGTTGAGACTGGCATCAAGTTCGTTCCCAGCCAAACACGCGCATTTCGTGACGACGACCGCTGGACTGATCGTACCGGCTGACAAAGAAGTGAT
CAAAATCAACGTCAACCGGGGGAGTTTGTTTGAGGAATCTATCGAGGCGCTGAATGGGATCCCACTGGAAAGCGTCCACACTGTCATGCGCGTGAACTTC
GTCAACGAAGCAGGAGTGGACGCAGGCGGACTACAGCGAGAGTGGTTCGTGCTGCTCAACGAGAAGTTCGCAGATCCGTCGAACGGTGTGTTTCGATGCA
CGAGCAAAGCGGACCAGACCTATTACCTGAACCCAAACTCGCGCCACGACATTGGCGAGCAGCACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG
TACTTTTTCGCCGCCGGTCGACTCTTTGGTCGCGTCTTGCTCGAAGGATCGGTGATCGGTTTCCACTTGGCGCTGCCATTGCTCAAGATCATCCTCGGTA
TCCCGATCGTGTTTACGGACTTGGAGCACTTTGACCCCGAACTGTACAAGAATCTGGTGTGGATCCTGGAGAATGACGGCGTCGAGGCTCTGGGACTGGA
CTTCAGCGTCACGGAGAAGCGAGGCGCCGATGGAGAAGTTGTCGTTGTGGNNNNNNNNNNCTTGATCCCGAACGGCCGCAGTATCGATCTCACCGACGAG
AACAAGGAAGAGTACGTACAGCGACGGTTCCGGTACGTGCTCTTCGAGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTCAGTTGGTGGCGTTCCTGAAGGGCTTGTACGATGTGATTCCACTGGAGCAGTTCCTGATCTTTGATCCAGAGGAGCTGG
ACTACTTCCTCTGCGGCTCGGATATGATCAACGTCGACGACTGGCAGCGCAACACCAAGTACACAAGCAACCTGAGAGGCCACCCTGCACTCATCTGGTT
CTGGGAGCTGGTGCGCGAGATGCCCAATGAGTACCGTCAGCGGCTGTTGCACTTTGCAACGGGGTCGTCGCGCGTCCCGATCGCGGGCTTTGGATCGTTG
ACCAGCTACGACGGCAAGCTGTGTCCGTTCACGCTGAAGGG