Description :
From Genome Similarity Track
Location :
Scaffold_65:172798- 174418
Transcript NameFunction/comments
Physo_138621hypothetical protein

Sequence
1620 bases(100 bases per row)
ATACATGTGCAGCTTGGCCATCGTGTATCGCTTCACCACGACGTACTTTTTCCCATCGCTATCATCATGAGCCGTGAGCACCACACCACTGGACATATCC
TTTCTTATGCGATTCGATTCGTCGTACGGATGGAGCTCATCGTGGTCAACGTAGTCGGTAGCCAGAACAGCTGAGTTGTCTCCAAATCGACAGTAAAAGA
CGCCATTTGACTCCATTTCCGGCATCTTGACTGAGTTCCTTCCCGTCTGCTTCGGTTGCGCGATAATTCGCTGGTGCATAAAGTTACACTTTAGAGTCCC
GGTTGACTGCAGATACACATAAAATCAACAATTGGCATCCGCTTGAAGAAGCAAAGGTAGCATGAAGCGTACCTCCCGCTGCGCAGTAATTCCTATGGCT
TCATTCAGAGTTTCGTCTTTCTCGGTGAGCTGGTTGTAGATCCCACGAGCAACCTGGTAAATGCTCACCCCGTCATATCTGGAAATAGTAAAGTTCACGC
AGTAGTGTTTGCCGAACTTGTCGAACATATCCGAGAACTCGTGGGGCTTATTGCAGTCCATTCCAAGCGTCTTCTGCTCGATGAACTTGTACGTCATGTC
CAGCTTCTCCTTGCGCAGCGACAGAATAGTCTTTCTCCTCTCGCCCAAGTCCTTCCCAAGGCGAATGTACGACTCCAACGGCGTCATTAACGACATCCTC
TGTTCACCGCAACCAACCGTCAACCAAAAAAATAAAATAAAAGTTAAAATGATAGCACAAAAACTCACCACATCATTCACTGGGGCGAACGCCAGCATAG
CCTTGAAATTGTCTGCGTACATCTTCTGCTGCGTCACAAACCCGTTCAAAAGCTGGCTCTCCTCCTGACTCTTCAGCAACAGCTTCATCTGCTCAGCAGC
GTCTCGTCCTCTTCTCTTCTTGATACTGATCCATTGCGGTCGACTCTTGTCCTTAAACTCGAGAAACTCCTTCTGTGCAGCCAGATACTTCTCCTCCCTC
TTCAACAACTCCACTTCTTCTTCCTCCTTCTCCATCATCTCAACCTCGTCTTCTTCATCTTCAGTGTGGCCCGATGATGACGAATCACAGTGAGATAGTT
TCAAAGGAGACATCACCCCCTCTCTGTTAGAACCTTGCGTCAACAGGGGGCTCTCCACCTCTCCATCCGTTCGACCCGGCGAGTCTTCCAGAGCATTACG
CCACGAGCTGGTAGCGGGGCTCAAGGGCAGCATCATGTCCAGATCCGGCACAATGATTGCGTCATCGTTCTCCTCCATACCTCGCAGAAATAATTCGTCC
TCCAGTAAAAAGTCTCCCAGTTCAAGAGAATCAACCGGCGATGAAAAAGAAGAAGAAGAAGAAGAAGAGTTGGTGCCGTCGCTCTGGGGGCTGTCAGCGA
CCACATTCTGCTTGCGAGAGGGCGTGAAGGGTGTTGGAGCGACTGTGGAGCCGTCGTCGTCCTCATCCAGCAGCTGCAGCATGTCGTAGTCGCGCGTTAA
GTCGGCCGGGAGCTCGACGCCCATGGTGTCCAGAACGAGAATGAATTTATGCGCGACAGACGAAAAATAACATTAGATTGCGAAAATTGGCATTAGGTAA
TCCTTAGTTTACGTGAATAA