Description :
From Genome Similarity Track
Location :
scaffold_54:17276- 18912
Transcript NameFunction/comments
Plaha_PHALS_02171hypothetical protein

Sequence
1636 bases(100 bases per row)
TGGACTCTTTGGCTTATCATGCTTAACATTGATCCAATTCACACTGTTAATTGCGTTATGGACACTAAAGAATTGGATGATGGTGCTTTTTGGTTATTTG
TGGATCCGTCTCCATTTCTTTTTTGGCTTTCTTTTGTTGGTTTATCTATCGCGGGTATTGGATATCTAGTTATCCTCGTCAAAATGGTTGCTCGTCGGAG
ACGGCGAGTAATGCAGACGCCGGAATTGTCGACTATTTCAACCGCTAGTTTAGTACAAAAAGTGACGAGTCAGTCGAAGCTAGCAAGTCAAATCGCTTTA
CGATTCACCTCTTCAACTCAATCAATTCGTACGCTTATACAAACTGATCGAATTTCTCGACGATTTGCTGTGAGTTGTAATCGTTCATTCTTTTATTCAT
GCCATCACTAACAACTTTGTGTCCTTTATGGATAGTAGCTTGGGATGAAATTGGGAGATTTAGCTTTTGAAACGGTTTTGCTCATTCAGATTTTGGAGGC
AGGATCACCCGAACCGATTATTGCGATTTTTACTTTTATCATCATCTCAAACGCATTGACATGTGTCGTGACAATGTTTATCCCCTTGCAACGCATTGGT
CTAGTTGAGACGACTGTAGATCTGCTGTACGTTTTGAGTCTTAACATGTCGATCAAATGCTCATCTAATCTATAGTGTTGTAGATTCGATTTGCTTATCG
TCGTTGTTTGTCCGATTCTCGTTCTGGTATTTTGCATGTCAGCCTTCACGTTTCCGCGAGATATATACGCTATTAACCACGAAGTGTTTCCACCTGGATG
GTTTGAACGACAAGCGAGTGTTGTAGCAGATCCGGCGCAAACAGCAGTGATTTACGAAAATTTGAAATCAATCCGTATTACCTCTGTCGTCAACTTTATC
GCTCGAATGGCCGTGAACGTCACGCTTTATATGCGACTTCATCGTATGGTCAATCTCATTCCGTGGAGACAGCAAAGTTGCATTTACCCACGTAAACATC
GGATTGCTGCATTATTGTTGGTGGCCTATGCCATTTTATTGGTCATCTTTGTGGAAGAGAGCGTTCGGACGTCTGCGATCGCGTGTGATCCTCATCCAGA
ATGTGTTCTGCATGCACGACGATGGACGTATTTGAAGTCTAACTCTTTGACACAATGCCCTTGTTTAGTGATGATTGACCGTGATGTCGCTCCAAAAACT
TATGACGAGTGGGAACAACCTTTAGATGTGACTAAAAAGGTTGCTCAACTTGCGTCTAGAGGGGATCTCAAGACTATGCAATTGACAAATCGATATTTAC
CGACTTTACCTGAAGAACTTCGACGATGTACAAATTTAATACATTTGTACGGACTGCTTGGCTTCTTAAGTAAACGTTCTGTACTAACACACTTGAACTT
TTAATGTAGAACGTTGGAGTACACGCACACTCAGACTTTACCCGATTGGATCAAGGAGTTGGCTAATCTTGAATTCTTGTACGTTTAATTAAGTGATTTC
TTTTGATTCTAAACATTTTTTATCGTGTCATTTCCCCGTGTGATATCAGACATCTTGAGAGCAAATTCACTAGTCCGTTTATCAGTCTGCCGAATGATAT
GTTTGAGGATATGACGTCATTAACGTTTATCCACCT