Description :
From Genome Similarity Track
Location :
Scaffold_123:17276- 18477
Sequence
1201 bases(100 bases per row)
TGTAACAGGGTTACACGCACAAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCC
ATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTTTTAGCCGATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCC
TATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAAGAGCAGTTCTCATTTTAACCCAACAACATTATTTGGATCGTTTATTTAGATT
GATCTATACTCGGAGGTTCGAGTATAATTAACTCTAGTTTAAACCAAGCTACGCTTGCTCGTACACATGCGCACACGTGTAAGCTAAAGTAGTGAGCCAA
AGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACGATCGACTACCTGAGTTCGTACGCCACCGCACGAACGCGGAGCTGAGAACCTTCCCA
TGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCATGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGCCCCTCCA
ACGATTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCCGCGTACGGTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAG
GAGCAACACGGTGTTGCTGCTACTAGCGCGGTGCCGTCCGGGACGACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGG
GTGACCCTCTCCTCCGCTGGCTTGTCGAACTCGACACTGCCATCGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGGTCGCCATGTCATCTCT
TGGCGGACGTGCTAGAAGTTGGGCGTATGGACGCCTGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTT
TTAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTTCTCGACCTGCAGCAAGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTG
GTCTCGAACATCGTGACCAATCCGATCAACGAGGCGACCAAGGTCGTCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N