Description :
From Genome Similarity Track
Location :
Scaffold_38:172746- 180114
Transcript NameFunction/comments
Hyaar_Emoy2805376TE4
Hyaar_Emoy2805377hypothetical protein

Sequence
7368 bases(100 bases per row)
TCACCACGGACTCGGTCATGCGCCGTATTGATGGCAAAGGTAAATCAATCGGCATGCTTATCTTAGTCTTGTTGGTACACATCAGTGACATACATCTTGA
GCGCCCTCGTCAATGTTTGGATCATCCGTTCGGCGGTGCCATTTGCTTGAGGCCTATACGCCATTGTAGCACGTTGCTTTTGACCGTCAATACAGTTGAA
TGCGAGAAAGAAATCTGACATGAACCCAGGCTCGCGATCATGAAGAATATATTCGCTCGCCCCAAATCGCCTGAAGACGCATTCTTCATACCCTTCCACA
ATTGTTTGGCCATTTCTCGACGAGCTAGCCTTAGCAATCACGTAGCCAGACAACAGATGGACCCAAAGATACAATTCCGTGTTTTCTTTGAATGATAAGA
AGGGGATATGATCGATCGCAATAATATGAAACGGGTGCGTATCTTGCCTGTTTCCCGGGGATTCTCCACGTAGTACCGGACATTCCTTCCCGGTTTTGCA
GTCGACACACTTCCCCACATACTGTTGCACGCTTCGAACAAACCTCTCCAATGAAAGTGTAATCGCACGTGGTGATACGTGCGGCCCACTCCTTGATGAC
CCCCTTCCAGACTTGCATGGTAATGGTGTAGAATGTCGTCTTGGAGCAACTCCGGGATCACCAGACGAACGAGTTCAGCACGATCATCGAGATTTGTCGC
CGATCGCGGGCAAAAATACAACAATCCGCCTCCATCTACCACGTAGTCAGGGGAAATCAAGGCAATTGCTTTTGCTTCCACAGCACCCAGCTCGGTTACC
TCTTCGACTAAGTAAAGCTTGAGGTTAGCGATCCCACTTTCTTTGTATTGCGCCTGTTTTATGCGATCAAGTCGCATCTGCTGTACTACTTCTTCTTGCA
TAATGGTAGACGTCTCACGTCTTCGCATAGTCGATCATGTGATCGCCGCCATCTTTATCACTTGATCACTACATACTGGAGTCGGTATGTCGGGTAATCA
ATTGATGGTACTCAGATCGTAGAAATCCTGATCAGTTAGCATAACCATGACTTTTTAAGCTGTAAAGCGATGCTAGCCAATCGATCCGTACTTTGATTCC
AATCGCGCTTAGCGCGTAATAACTCATTTTTTGGCAATGATCTGAGTTGTTCTAGGGCCTTGAGTTGCAGCAATTATAGCCCTGGTGCCTTGCAATTAAT
CTCACCCCGCATCTGCCTGATGACCAGGTTGGAATCATCACGGATGACAACTCATCCCCTTGTCTGTTTTGCTAGCAGCTCGCAACTCAGCAGAAACCTG
TGATATTCTGTCTCACTCACCGTTAATACAGTATCAAACCGCGACGCGGCTGATAGTATTGTCCACTCGGGCAATTTCCATATCACTGCGCTGTAGGCGC
CCCTTTTTTTCTTGATACGTGCTGACCCGGTCAAAGTTAACGACCAGAAGCACTTCGCCCTGTCTGACCGTAGGGGGAGGCATGGTGATGGTTTGTCTCG
GTTGATTTCGTGGTGCGATTGCGATCAACATCTCGTCCACCTCTTCTCGCGGTGTAATACTAGCTGCGAGGGTGCCGAGGATTTCGTCTTCGCCATTGTT
ACACCGAATGATCTCCAACGTCCAAGTCAACAGTAACGCTGCCCATCTCCGAAGTCTCGCATTGATACCTGATGATTGCATCAACGATGCCAATGTAGAG
TGTCTCGTGAGTACCTTAATGTCTCGCGAGACCAATAATGTATAGCAAATATCCAATATCCGGAGCAGGGCCAGGACTTCCTTCTCTACCGCTCCGTAAT
TAATTTCATTTGGTTTTATCGTTCAACTTGCGAACATAACAGGACATTCACTCCATCATGTTCTTGCAACAAAGCTGCGGATACCGCCCATTTGCTAGCA
TAAGCCACGATCACTGATCGGCGGTCTGGATCAAAATGCCTGAGCACCGGGGTTCGGGCTACTTTAGCCTTCAACATGGTGAACGCAATAATGGCTTTTT
CCCAACGATGATCACCAGTATGTTCTCCATCAGACTCTTTCACTTTAAATTCATCCTGATCATTGATTGTCACCAGTTGATGATCGTGATCACCTGCAGG
CCACTGTCCGCGGTCATCACAAATCTGGGCGCTACATACGTGATCATGGCTGGATGAGCAGTCATTCTTCATGTTGTGCGAACGCCTGATCTCATGGAAA
TCTGCTTCCCCCAATTCGTACAGGAAAGAGGCGTACATGGCAAAGTCTTGAATGAACCGGCTGTAGTAATTCATGCTTTCGAGGAAGGACTGCATTGAAC
GCAATGTCTGGGGAAAGGAATATTCACCAACGAACCCAGATCCTTCGGGTCAGCTTCGATTCCATTTATTGACACTTGGTTCCCGAGGTACTCAACCTTG
CTTCGCTCTTAGACGTCTTAGGTAGGCTGATCGACAAATTCCACTGATCACATACGTCCAACAATCTGTTCACCTTTTGATAGAGATACGTCCAGGTTGA
CGCCGGGATTAAAATGTCATCAATGTGTAGGACCTTCGTTCTAGAAGAGAAGGACTTCGATGCGGGTTTGGCTCGCCGTCTGTACACATATCGACCGGTT
GAAACACCTCGTGGTCACTTGACTTCCGCCGATCCCCGATCGCAAGATACCCATACAATGCGTTATCCACCATACGTTGATATACCTGCGAAGAGTTCCT
CAGCCCGAACGTCATGCATAACCATTCATACAGACCTGAAGGCATGATAAAAGCAGAGATCATTCATGATCTTTCTGTCATTTCTACCATCCAGAATCCG
CTGGCCGTGTCCAGCGAACAATACCATAGCGCTTTGTCTAGATCCTGCAGCAAGTCGTTAATGCAGGGCATGGGATATACTATCGGCCTCGTCAATTGGT
TAGCTCTTCGGTAGTCGATACACAGTCGTATATCCACTCCATTCATTTTCACGATCACCAAGATCGTCGACGCGCATGATGAAGTTAAGGAACGTACGAT
TTTAGCCGATTGTAACCCTTTGATCAGGTCCGCCAACTTTTCGCGGAACTTTGGGAGACTGGACTTAGTAGGACGTTGTTCTATTGGGGCTGCTCCTAAG
ACATCTATATTTCAGATTACGCCTCGCGCGGCAGGTAGGAAGGCTCTTCCTTTACCCATCAGAAGGTGTCGTTTCTTCCTGATCAGCTGACGCAATTCTT
CTTGCTCCTTGGTCAATGGTACCCTCAGGTTGCCCACCTGTATATCGTCAATTTTCACCTCGCCCAGCACATATCTACTTCTGGTAAGAATGCCATATGT
TGGCCAACATCCTCTGCGAACAACACTCCACTCTCGTGATAATATGACAAGCACTCGTGCGCTCCTTCGCTCGTGACAGGTGTCAATTTGCCCGCCTGAT
TGCCGGACGGCCGATTTGCCTCATATTCCTTACCAGTGGCCCTGTCTGGGTAATGGGTGAACCGGTCTTGCACGCGATCAGATACCCTCTCACTGATCGA
TTCGGGAGTTAGCTCTCCCTTACAGTTTTGAGGCTGTGTTTTCGACTGGTCCCGCACCATCTTGACGTCTTTAATCACGTCGGGGGGGGGGGTATTCGTG
TCAACCATTACTGGCAATCGCGTCGATATCCCTCTCTCGGATTCACTATGTTGCTCCAGCTGATCAGGCACCGGATCCCAAACCATTTCACCTTCACTAG
TCCTACTAGTTGTGGTGATCGCGTTGATGACTACCGGCAATTGTCCTAAATGTGGTCCTTCAAGGTAATCTTGTTTGTCCACATGATCATATATCGGCAT
ATCACCTTCCAACTTTGCTTCTTCTTCTTCCATGGTCGTCTCTGCTATATCCTTCGGCTGTCGCTTTAGAATACGCGTTGGTTTAGGATATGAAGGGTGT
TTTACCAACGGTCCATCTACTCCAGGCTATGCTTCATCCTCTTCTTCCGTGGTTGTTTCAAACGCGAGTGTCTGCCACTCCTGATATCGCCGTGATCCCA
CGGACACATACCTGGGTGATCGTGGTATCGTATCCGCCAGCCCCCGTTGCCCGAAGGGGTGTCCCTTGTTGGATGATCACCTCTTATTCAGTTAGATTGG
TCGAGCGAAGGTAAGTCAACCTTCCAAATCCATTCAAAGCCACAGGTACCCAGCGTGAGTGACGTGTTAACCACAATTTTGACTGAAGTGGTCCCCGACC
AACGTTGATTTCTACAGAGTTACCCACCGCAATCGCCAGGTACTTCTCATCCGCGGCAATCCGTTTTATCTTCGCCCCATACGGTGGTCTTTTACCTTCC
AGTTGAATTCTGACCTCGTCCGGCAAGAAAACTGTCCCGTCTGCAAGGTCAAGGCGTATCCCGGTCGGTACAATAAAATCCATTCCTAGAATTGCTTCTT
GTCTCACTTGGTCACGAACCCATACATCAAAGTAATCGACTAGTGACCCGTTCAGCGTGATCTTCACCTTCGTGCGGCCTTCGTCCATGTATGATTTCTC
TCCAATACCCACATATTCTTGCTTCTGACTCTCATATATGATACAGCCAACCTTACGAGCAAAGGTGGTGTCGATGATCGAGACTTCGGCCCCCGAGTCA
AACAGTAGGGTGGATTTATCATTGTTGATTGTTTCCCCTGACTTGGCTTGCCTGAACCACTTTTTTGGAGTATGATACTTCCAGTAACCACGTGATTCGC
CAGGAGGCAACTTGAGTTCCATCTTGGTAGGTGGTCGTGCATTTTCATCCGGTCGTCTCAGACTTGCAATTGAAGGCAAACAACTAAAATTCAAATCATA
TGTACTGAACGTCCGGCCGGTCAGACCATCAACACTGTTATCAACCCCTTCTCTTTCAATGAATGCATATATACACAGCCTAGAAAGCTCGGCTCGTACC
AGGTCCAACCTGGTGATCGTTCTAGTTTAACATCTTCTCAGCGTTGGGGGGAAGCATTCCAGCATGTTTGGTTGGCACGTACCACTTGCGGAGCATGTTA
TAAAACTTTTGCATCGGGCATTTTCCTCCTTCGTGTACTTCTCGACACGCCGCGCACCCGTAGAAACACTTGTCAGAGGGGTGACCTCGGCGTCCGAACT
TCTGGCACGTCAACCGTTTCTAGCATGTACGATCATCATGTCTTCGACCCACAATGAGTGCACGACTTGTGTACTACTGTACGATCCTGATTCACGTTCA
CAAGCACCCAATCTTGGCTTGGTCAGACGTTCACTAGTTCGATCCGTCGTTTGATCGGCTGCCGTAGCGCTGTAAACACGTAGTGGTTGTTCTTCTGAAT
CTGAACCGCTTATATCTGATCCCGAAGAACTGCCATCGCCCCCCACGTGAATTGCACGCACGGCTCGGGCCGGTTTCGATGGACTTAGGGTGTATTGTGA
GGCTGGTCGTTGGCGGAACTTGCTTATATTGGTCGGGATGTCACCTTTACGGTTCTACATACGCTCTTACGTACGCAGCGTTTCCTCCAGTATATTCACG
TCATCTAATCGCAGCAGCGTTAGTTGTTTCGCGAGGTCTAGATCGTCCAGTGTCTCTATGTAATGTTCCACATGGTCACGGCGATCGGCTATATTTCCAT
CTTTCATATGAATTTTTGCTCGCATTCCAGCAACGTTCAGTCGATAGAGATATTCTAACGGAGTCTCATCGGCACGCTTGCAGGCGTGGTAATACTGTCG
ACCAGCTGAGATGCCGCGTCCACAGTATTATAAAAGAAAGTTCTCGAGTACGTCATTCCACTTATTGCGTGTCGATCAGCTCAATTAGGAATACCAATTT
CCAGGTGGGCCTGTTAGCAGACCCCCAAACACCAGACACTTCTTCGAAACAGTACTTGGTCACGCAGGAGAGCTGACCCGAACTTGCGTTACCATCCTCT
GATGCGGTGAACATCGTGATCGCGGCCCGAAAATTGTTTAACTCGGCAATCGCAGACATGCGAATTCGTTGCGCGGCGAAACTCCTCCCAGTAATGGCCT
CAGTAGTAGCCAACTGGGGTCGTCGTAGAACGTCTATACCGATATCATCAGGTATGCGTTGCCGCGACTGTGGTGCGGGCCAGCTGATTACATGTCGGTG
TCTGGCATAAACACACCAAACACATTGTGGTGGTGGGGACGACCGATTTGCGCCGTACGGGGTAGTCGACGGTGTTGGCCGTGTAATGACTTCTCCATGG
ATTTTGAAAAGTAGATTTGCATCTGGTCGGATTCATCCATAGCGATATTTGCGTGGAGTTGAACCCATCGCCATCGTGGTCGGAGCGGTATGCTCGTGGT
GGTCACGCAAAAGTGCTGCTCCAGATGGTCCCTACGACATTCTTTTGATCTCCATGTCATCGTTTTCCTCCGCATCCGACTCAGCAGAGGCATAGTGCGA
CAACACAGCCGGAGAATATTCTTCCTCTCTGACCTTAACGGTGGTCGTGAGTTAGCGATCGGTCGAGTCATAATTACCGGTAATTGGGACCAGCGTTTTA
ATCAGTGATCGACCGGCAGTGGCCACCTCATCCAGGTTGCAGATAAGCAAAATCTGTGTATCGAACGCCCCCGGTACAAAGCCTACGCCTTGTAGCAACT
TAATGAGCGTTGTACCACTTCCATCTTGTTTGTCGCGGCTCGTGATGCCATCGCAGGTCCTCGGATCGGTCCGATCAGCTCTGGTCTCAAAATCGTAAGC
ATCGGATCTGTGAACAGTGAGTCTTGAAGATGGTTCCAGTACAAACTCCACTGTAGCTGATCAATATTTCATCCGTCCATCTTCACCTCTTTTGCTGCAC
TCGTTTCCTGTTCGTCGCCTTCAGATTCAGGCGCTCGTAACTTTTGAGCCGCAGCCTTTGATTTTTTTCTTTGTACTTGTTTTTGTTTTTAGACGAAACA
TGTCCTGCTTTGGCTGGACGTGTTCCGTCTAGCGGGTCGTACTTTGCAGTACGATCCGCGGTAGTACCCGAAGGGACCTCAGGAGGGAATAGGGTTTTTT
CTTCGTGATCACCTGAGGGATCTTCCTATCTAATTTTCAGCTCACCCGAGCCCCTCCCCGAACTCTGACGAACCGAGGATCCTAGATGATCACGTGTCTA
CGACGATCCCTTCTTCGCCGACTCTTCCATCCCCGGTACAACATTGACCTTGACATCTTCGCTTTGGGGTTCAAGATAAATTCCCGAGTCACCAGAAGAT
CCGGACACGCGAATCATTGTGGTGGAGTCGAATTAGCTCATTCTCTGAGGCGATCTCGACTCTTCACTGGCGCCCAGACGATCTACTAACGGAGGGGTAC
TCCGATTCCGTGATGTTTGCCTTCCTCACCTTGTTTACCCGTCGGTAGGGCGGATTGCACTCTACCAG