Description :
From Genome Similarity Track
Location :
Scaffold_38:172745- 176090
Transcript NameFunction/comments
Hyaar_Emoy2805376TE4

Sequence
3345 bases(100 bases per row)
CTCACCACGGACTCGGTCATGCGCCGTATTGATGGCAAAGGTAAATCAATCGGCATGCTTATCTTAGTCTTGTTGGTACACATCAGTGACATACATCTTG
AGCGCCCTCGTCAATGTTTGGATCATCCGTTCGGCGGTGCCATTTGCTTGAGGCCTATACGCCATTGTAGCACGTTGCTTTTGACCGTCAATACAGTTGA
ATGCGAGAAAGAAATCTGACATGAACCCAGGCTCGCGATCATGAAGAATATATTCGCTCGCCCCAAATCGCCTGAAGACGCATTCTTCATACCCTTCCAC
AATTGTTTGGCCATTTCTCGACGAGCTAGCCTTAGCAATCACGTAGCCAGACAACAGATGGACCCAAAGATACAATTCCGTGTTTTCTTTGAATGATAAG
AAGGGGATATGATCGATCGCAATAATATGAAACGGGTGCGTATCTTGCCTGTTTCCCGGGGATTCTCCACGTAGTACCGGACATTCCTTCCCGGTTTTGC
AGTCGACACACTTCCCCACATACTGTTGCACGCTTCGAACAAACCTCTCCAATGAAAGTGTAATCGCACGTGGTGATACGTGCGGCCCACTCCTTGATGA
CCCCCTTCCAGACTTGCATGGTAATGGTGTAGAATGTCGTCTTGGAGCAACTCCGGGATCACCAGACGAACGAGTTCAGCACGATCATCGAGATTTGTCG
CCGATCGCGGGCAAAAATACAACAATCCGCCTCCATCTACCACGTAGTCAGGGGAAATCAAGGCAATTGCTTTTGCTTCCACAGCACCCAGCTCGGTTAC
CTCTTCGACTAAGTAAAGCTTGAGGTTAGCGATCCCACTTTCTTTGTATTGCGCCTGTTTTATGCGATCAAGTCGCATCTGCTGTACTACTTCTTCTTGC
ATAATGGTAGACGTCTCACGTCTTCGCATAGTCGATCATGTGATCGCCGCCATCTTTATCACTTGATCACTACATACTGGAGTCGGTATGTCGGGTAATC
AATTGATGGTACTCAGATCGTAGAAATCCTGATCAGTTAGCATAACCATGACTTTTTAAGCTGTAAAGCGATGCTAGCCAATCGATCCGTACTTTGATTC
CAATCGCGCTTAGCGCGTAATAACTCATTTTTTGGCAATGATCTGAGTTGTTCTAGGGCCTTGAGTTGCAGCAATTATAGCCCTGGTGCCTTGCAATTAA
TCTCACCCCGCATCTGCCTGATGACCAGGTTGGAATCATCACGGATGACAACTCATCCCCTTGTCTGTTTTGCTAGCAGCTCGCAACTCAGCAGAAACCT
GTGATATTCTGTCTCACTCACCGTTAATACAGTATCAAACCGCGACGCGGCTGATAGTATTGTCCACTCGGGCAATTTCCATATCACTGCGCTGTAGGCG
CCCCTTTTTTTCTTGATACGTGCTGACCCGGTCAAAGTTAACGACCAGAAGCACTTCGCCCTGTCTGACCGTAGGGGGAGGCATGGTGATGGTTTGTCTC
GGTTGATTTCGTGGTGCGATTGCGATCAACATCTCGTCCACCTCTTCTCGCGGTGTAATACTAGCTGCGAGGGTGCCGAGGATTTCGTCTTCGCCATTGT
TACACCGAATGATCTCCAACGTCCAAGTCAACAGTAACGCTGCCCATCTCCGAAGTCTCGCATTGATACCTGATGATTGCATCAACGATGCCAATGTAGA
GTGTCTCGTGAGTACCTTAATGTCTCGCGAGACCAATAATGTATAGCAAATATCCAATATCCGGAGCAGGGCCAGGACTTCCTTCTCTACCGCTCCGTAA
TTAATTTCATTTGGTTTTATCGTTCAACTTGCGAACATAACAGGACATTCACTCCATCATGTTCTTGCAACAAAGCTGCGGATACCGCCCATTTGCTAGC
ATAAGCCACGATCACTGATCGGCGGTCTGGATCAAAATGCCTGAGCACCGGGGTTCGGGCTACTTTAGCCTTCAACATGGTGAACGCAATAATGGCTTTT
TCCCAACGATGATCACCAGTATGTTCTCCATCAGACTCTTTCACTTTAAATTCATCCTGATCATTGATTGTCACCAGTTGATGATCGTGATCACCTGCAG
GCCACTGTCCGCGGTCATCACAAATCTGGGCGCTACATACGTGATCATGGCTGGATGAGCAGTCATTCTTCATGTTGTGCGAACGCCTGATCTCATGGAA
ATCTGCTTCCCCCAATTCGTACAGGAAAGAGGCGTACATGGCAAAGTCTTGAATGAACCGGCTGTAGTAATTCATGCTTTCGAGGAAGGACTGCATTGAA
CGCAATGTCTGGGGAAAGGAATATTCACCAACGAACCCAGATCCTTCGGGTCAGCTTCGATTCCATTTATTGACACTTGGTTCCCGAGGTACTCAACCTT
GCTTCGCTCTTAGACGTCTTAGGTAGGCTGATCGACAAATTCCACTGATCACATACGTCCAACAATCTGTTCACCTTTTGATAGAGATACGTCCAGGTTG
ACGCCGGGATTAAAATGTCATCAATGTGTAGGACCTTCGTTCTAGAAGAGAAGGACTTCGATGCGGGTTTGGCTCGCCGTCTGTACACATATCGACCGGT
TGAAACACCTCGTGGTCACTTGACTTCCGCCGATCCCCGATCGCAAGATACCCATACAATGCGTTATCCACCATACGTTGATATACCTGCGAAGAGTTCC
TCAGCCCGAACGTCATGCATAACCATTCATACAGACCTGAAGGCATGATAAAAGCAGAGATCATTCATGATCTTTCTGTCATTTCTACCATCCAGAATCC
GCTGGCCGTGTCCAGCGAACAATACCATAGCGCTTTGTCTAGATCCTGCAGCAAGTCGTTAATGCAGGGCATGGGATATACTATCGGCCTCGTCAATTGG
TTAGCTCTTCGGTAGTCGATACACAGTCGTATATCCACTCCATTCATTTTCACGATCACCAAGATCGTCGACGCGCATGATGAAGTTAAGGAACGTACGA
TTTTAGCCGATTGTAACCCTTTGATCAGGTCCGCCAACTTTTCGCGGAACTTTGGGAGACTGGACTTAGTAGGACGTTGTTCTATTGGGGCTGCTCCTAA
GACATCTATATTTCAGATTACGCCTCGCGCGGCAGGTAGGAAGGCTCTTCCTTTACCCATCAGAAGGTGTCGTTTCTTCCTGATCAGCTGACGCAATTCT
TCTTGCTCCTTGGTCAATGGTACCCTCAGGTTGCCCACCTGTATATCGTCAATTTTCACCTCGCCCAGCACATATCTACTTCTGGTAAGAATGCCATATG
TTGGCCAACATCCTCTGCGAACAACACTCCACTCTCGTGATAATA