Description :
From Genome Similarity Track
Location :
contig_54:17271- 19140
Transcript NameFunction/comments
g9123.t1hypothetical protein

Sequence
1869 bases(100 bases per row)
GGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTT
CTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTC
CGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATACTCCTACGCTTCCTCCTACACGTGCGCACACGTG
TAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACAGTAGCCATCGCCCATGTCGAGCGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACG
TCCTTGCGAGGATTGGCGTGGTCGCCGGGATGGTTGCTGCGTTCAACAAGTTGAACGCATGTACCATACGTCACTTCCCATTGGGTTTACGCACGCAAAA
CGTCGGGGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCGTATTTCGCCGCGAAAAATGCGTCGATCACATCGACTTGCTCCTTCGGTAGT
GGCCATTGGCGCGTGGTGCAGTATTTGGTGCCCGGCACCAAATCGATCTCGTGCCGCACACCTCGGTCTGGAGGTAACACCGACGGTAGGTTATCGCTAA
CGACATCCGAGAACTTCTTCAAGAGGGGGTAGTACAGATCCGACGGGTTTTTCAAAATGGCTGCGCCATATCGTTTCTGCCTCAAAGAGGACCTCTCGTT
CTCTAACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGATCAAGTCGAGTTCGCGGCGGATCAGGACCATCTCCTCGAGCTCCCCCGCCTTCAGG
GGGCCGGGAAACTCGACATACGAGAGATCTTCGAGTTCCAGTAGCTCTGCTACCGCAGGCAGAATTGCTAACTCCCCGCCGTCCTTGTACTCGCCCGTGA
GCATGTCCAATACCGCTGGTGCGACCACGCTCTGCATTGCGGCGTACTACGCCTGGACGTAGTCCCACTGTAGTTGTACCAGCCTTAGCGTCTTCCGACG
TGGGCGTTTCTGCTCGACCACTCTCGGTTGCGCGAACACCAACTCTAGCAACTTCTCGTGCGTGAGCTGCCGCAGCTCGAACGCCTTGTATGCCACCCGC
CCCGTGGGCAAAGGCGACGTTCTCGTTCTTGAGAGTTCCATGAACCTCATCCTGATGAGTACACAAAAAAATAATACCTTCTCTCACACGCACCGAAGGC
TCATGAGCTCTCGAACGTGTAGAACACGCGATCGGCATAGCCGAAGGCAGTTCAAGTATTTCCGAAGTGCCGTTCGCCGCGTGGCACACGATGTTCGTGC
ATAAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGACTCTGTCCGCGAGGGGACTCCCGCGACCGGCACGGATCGCTACAATCAAGATCTCT
CTGAGTATGGAAGCCTCAGAGAGCAGGCTGCCGTCCCGGCAGGACTTCCTCATCTTTCAGATGCCCACTGGGCTACACTGGAGAAGATGGTTAGTCTCCT
GGGCGAGGCAGCGTTTGCTGGATTCCCCAACTTTCCTGCGGAGCAGTAGAGGTCACGCGTGGAACGCTTCGACATCTACGAGTCGTCGCTGATTGCTCAC
ATAAGTACTGTGGCGCAGGAAGCCGCTCGCACGGCGATGCGAGCTGATGCACAGAGTGTGGCACAGGCGAACCCCTCGGTCCTGCTTCATATACAGCGCG
ACAAGGAACTACGAAGACCGTCAGGATGTCGGTACAGACGTTTGACGGCAAAGAAGCAGTGTAATGGGT