Description :
From Genome Similarity Track
Location :
Scaffold_166:1727- 5632
Sequence
3905 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGATCGACTCTCAGTTCGAGTTGGTTCGGAAGATGGCAGACATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGTATTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGTCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGTGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCCTTTGCACTCTCCAGCCTTAGCGGCCGTGCTAAGAGTTGGGTGTA
CACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTAGGCTCAGCTGTGCGATCAGCTCCGAGCCGCTTTCCTCCCGGCGGACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCTGCACGAGTATGTGCAAGAGATACAGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCACCGCACGCACATAGCAGTTCCGGGTGCAGTCAAACGCCCTTGAAGAGGCGAT
TCAGGTGGCTCTTCAAGAAGAGTACAGTCATCGCCGGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AGCGGACCAGCTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTATCCCGCGG
AAAGACTCCGCAGACGGTCCTTCCGCAAGCCCGTCCTCAAGGGTCGCTAACAGAAGCCAGGATCCCGGGGACAGTAGAACGCCGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCTCGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGG
CGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAAAATCTTGATCGATTCAGGGACGTCGAAGCATTTCGC
ACGCCGCCAGACGGCTGCTCGTAGCAGCAACAAGTTGTCCAATGCTTTGAGTGAAAGCAAGGGCAACGGAACGGTAGCAGTGCGACTGGCCGACGGGAAG
GTCGTCACTGTCCCAACGTCCACGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCCCTGTTTTCGACATGGATCCGTATGATAT
GTTCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCAGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCACCCTGCGCAGTCCGACAGAGCATTG
GTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCACCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGACGCTTGGGAGTCGTCGACGTATATG
ACGACTCCGAGGAAGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGC
TGCAGCTGTCAAGAACACTGACAATAGTGTGCTCAAGGTGGGGTAACAGAGTTCCACTCACGGTCACCCAGACCTTAACTGAAGAGGAAGACGTCGGATA
CGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCCGAACACGCTTTCTGTGTGGGTACCATAGTACCA
CACGAGGCCACGAGTACCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCC
GCCTCAAGTCGGATCCGAACTTCGTTCCGATCAGCGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTG
TCAGGGCCCGAACTCCTCCGACAAGGCCGGTGGAAGAGTGGCGTCGTTGCCGACTTCCCCAGACGTGGGTAGCAAAGCTCCACGTCACGGTCGCCGTCGT
CAACAACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCAGCGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGC
CGGTGGAAGAGTGTTGTCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACT
GAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACGAACCTCAAGGCTGGAAAGTTTGCTGAGATGTTACTCATGAGACCTGAGACCACTCGAGAGGAG
CTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCGTAAAGAACCCCAAGGATT
CGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGCACAAGATTGATCTTGTG
CCCAGCACAAAGTATTGTGTCACGAGGCGATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGG
TGCGGGAGTCGAAATCCCCGCACTCGACGCCAACTTTCTGCGCTCGAAGCCGAACGGAAAGTGGCGTCTAGTTCATGCTTATAACAAGCTGAACAACGCG
ACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGAATACT
TCCGAATCCGGATGCGAGAGAGCGACATCCCGCTCACCGCGGTGATCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGGCTAA
CGCCCCGGCGACGTTCAAGCGTCTGGTAACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCC
GAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTGTACGCCAACATCGACAAATGCG
TTTTCGCGTCACCAGAGATTAAAGTTCTCCGTTGCTTCGTAAACAACGTGGGCGTTCGGGCTGACCCAGACAAGGCAAGGCCATAGCAGCATGGCCGACG
CCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCC
TCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGTACCATGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGACCCCTGTCCTGGCCCTGCC
GGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTACATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATC
TCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCAGTCCACGACAAGTAGCATCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTT
CACCT