Description :
From Genome Similarity Track
Location :
Scaffold_1247:1727- 4206
Transcript NameFunction/comments
Phymu_g12991hypothetical protein

Sequence
2479 bases(100 bases per row)
TGTAATGGGCCCACCAGTTACATATGTAGGTAGCTTTACTTTGAGATTAGTACATAAGTAGGCATTCTAGCACACGGCCAGCGTGTGCTGACATGGCATg
ttctgattggttgaaaaatGGGGAGCCAGGCCCGTTTATAGCCAATCAGTAAATAGCTTGATTTGAGTGATTTACGTTAGGCCGCGGGCAGCCGCCCGGC
TAAAACAGAGTTAAATTTCCCCCAGACTAAAGACTTGATCTCAGCTTGCCTGAGTCCCTttagcagcttcatcgccgCTACGTGTAAGCTAGTGACGGTA
TCACCTATCCCGTTACACCTGGTAGCACTTAGTAGTCCTTTCAACGTCCAAGATGTGCCAAGTCATGTCGTCTGACCCCTCGAGAGGGACTCGGGGGCAC
GAAGCCTTTCCCCACCTCACGCGTGTTGAGTGGGAAGCTCTCCACCGCCTCGCGGCGGTGTCCGGAGAGTCTGTTgtcacgacgctgctgagcacAGCGC
CGCCTGATCAACAGCGCCAAGTTGTCCAAGCGTTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGAACATTAACTCCCTCTCGTCCATCCAAGCATGG
CGccgtgaagatggagacgtcgacCTACTCTGGCGTCGGTCAAGACCGACTCCCGCTGAATCGCTGGTTTTGAGAGATCGacatcgccatcgcctcgaGG
CTGATCGAGGCGCCGTCGGCGAAGGTGAACTTCCTTCTCTCCCGGCTGTCCGGCAAGGCTAAAGAGTGGGCTCTCGGTAAGCTGGTGGTTGGCCAGCTTG
CCTTCCCTGACCTGGAGGCTCTCCAGAAGGACCTCCGACTTGCGTTTGAGCCACCTCAAGGCGAATCACGTGTGCGCGCTGAGTTCTTCGCGCTCAAGTA
AGGCAAGTCCTTGATGCGCGACTACGTCCAGAAGACGCGCCACCTCGCTTCGTGTATCATCACGAAGCCGATCGACATGGCTTCACAAGTCCATGTCTTC
GTGTTTGGCATGCGCGAAGGGATGACACACTTCTGTTTCACGAGAGCAGAGCCGTCATCTCTCGAAGAGGCCTTCGCCCTCGCGCTACGCGAGGCCTATG
TTGTGGCGTCGTCATACGCCAAGGCATGACGACTGACGCCAGAGCCTCGGCTCCTGAACCCATGGATATTGATGTCATCGAGGCGTCGGACGACCGGCGT
CATGCGGCCTTCAATAATCGTGGCGGTCGAACCGGACGACGGATGCTTTGCTTCCGGTGCCGGAAGACTGGTCATCGCGCGGCGGTGTGCCGCGCGCCAG
CCCCCGTCCTAGCGAACGTCGAGGCAGACGTCCGTGACGACGTGATCCCGGCTGCTCAGTCAAGAAACGGCCGGGGTCAGTAGGCGCGGGGCGCCCTACT
GGCTGGAACGGAGGTCCGGGCCCCCCGGTGGCAACTCGACCTTCTAGCCCTCCAGTGCTTCATGCACATGCTAATGCCACCACTGCGAGCGGCGACCCCA
GACAGATCATCGCCAGTCTGTATGTCGTCGGCTCCAGGTGACCGCTGCGCGCGCTCCTGGACTCAGGAACGACGAACAACTTCTTCCGTGCGTCGTGCCT
GTCGGTACTGCCTCCGGGCATCCCGGTCCGGGAAGAGCCGGGCGAAGTCGTCGTCAAGCTCGCCTTTGGAAAGCCACACCGCGTAGCGCGGCGCGAATTG
TCGTTGCCGTACATGTTCGATGGCTTcggcagcaacgacgacttCTTGGAGATTGAGATGAACTACGCGTTCGACTGCATTCTGGGCACACCTTGGCTGG
CGCAGTATCAGCCACAGATCGACTGGCTAGCCCGATCAGTTAAGCGTCGAAGTGACTTCGATGTGAGCGAGGTGTTCACACACCTGCTGGTAGCGCCAAG
AGATTTGCCTCACGTCACCGTTGTGGACCAACAATCCACGACGCGAGTTGAGCACAGAGCGAGCGATGGCCCTCTCTGCACTACTTGTGCGGTGCTGCTA
GCTGACACGAGTGGACAAGCCTTCTCGCGATCCCACGAGGAGAGCGGCGCGGCCGAGCAGGGGCTCCCGTCAACAAATGAAGCGGTTGAGCAGGGGCTCC
CGCACGTGAACAATGCGGTCGAGCAGGGGCTCCTGCACGCGAAATACGCGGTCGAGCAGAGGCTCCCGTGTTCAGTGACGACGCCGGCGGATACCGGCGC
GGTTGACCTAGGCCTTTCACGCCTAGAGGATGGTGAGTCGTCGTCAAGTGAGTGCGAGTCGGCCTCGAGCAGCGGCTCAAAATGCAGGAACAAGTCCCAG
CGTCGATGCCGACGCCGCCTACGCAGATCCTCCGAGCCTAGCACCACCCTGGCGACAGAGTCGGTTTGCGTGctcgagtacgtggaagGCGCTCCAGTCC
GGCAACGGACTGTCGAGATCGCGAGTCCTCCTCGAGATGCTCACGCGATCACCCGCCTACCCGGTTTCTCACGGAGGCA