Description :
From Genome Similarity Track
Location :
Scaffold_1738:1727- 3551
Transcript NameFunction/comments
Phyag_g11379transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
1824 bases(100 bases per row)
TGCCGGTGATTGTGGAGTGCCACAGTGAACTTCAGCCCCGCCAGATTATACTATTCTATTCAGCGACGGTGGtttggttggtgctgctgcgtcagaTCGT
GGTGTTTTGTCGCTTCCTGACgcacttgaagctgcaggcagACAGCTCCAATGACTCTTCTCATACGTCTGCACTTGGCGACTGGTTTAAAGCGCTGAAG
TTGTTTCCGATCAGAAGAGAGCATACGCGACTTGTGAAGGAGTTTAAAAAACTCCTTTACCGGGCTGTCGCTCGTGGCGATGTTCTCACGGTGGAAACAC
TTTTGTCTGAGGCGGAATCCAAGTACAAGAtcgagcagatgcaggaCCTGTACAAACCTCCGGTTTTGTGGTTTTGCGCGTTCGCGAAATCGAGGAAGAA
TCCGCTACATATTGCGGTTAAGCGAGGCAATATCAGGATCGTTGAGCTGCTACTTGATCATGGTATGGATGTGAACGTGTTGGACAAAGTGGTGCGCGTG
AATTTTAACGTCAACCTGGTATTCAAAATCTTCAGTCGCATATTGGTAAGCTGTTGTCGGTATTTAACTGATTCTGTGTTGAACTAACTAGCGCTCACTT
TGTCTTGCAGGTTCGGACGCAAGACGGACTTAGATCACCTTTAAAGGCTCTCCTTTGCTCCGTCCTCCTCCCCCCACTCCACGGCGCAGTAGCCGAAGGC
TACGTTGATATCGTTCGTCTACTGATCAGCAAAGGCGCCGATGTGAATGCGTTGCCACGGGCATCGTTTTACTACCCAGCTGCCGTCCTCCCGCCAATCT
TCGTGGCAGACGACCCGCAAGTGCTGCGATTGCTTGTGGCAAATGGTGCAAACTTCCTGAAGGTTGCGTCTGTAGAACTGACAGGGCTGATCCGCACGTA
TGCAACGCCGTTGCAGCAAAGTACATTCACGCTGAGGTCAGACCTGAGTGACTACCTGTTGGAGTGCGGCGGTGATGTTGCGTTGACTCCACTTCACGAG
GCAGCAGCTACTgacaacgtcaagaagatcaagtgGCTTCTTGCGCGTGGTATTCAGGTTGACACCCTCGGGGAACGCGTCGAAGGTGTGCACCGTCGGA
CCCCATTGCACTGGGCCGCCGTTGTTGGGAAAATAAAGGCTGCCAAGCTCCTATTGAAGAAGGGAGCTAATCCCAACGCTAAAGACCGTGACGGGCGTAC
ACCATTACACTGGGCAGCTAGGAACAACCACGACGAGGtggtgtcgttgctgctcgcttACAACGCTCAACCAGACGCAGCTGATGGTGAAGGTATACCG
GTCGTGTGTTTTGCCGCGGAGGCTGAAGGTGTGGACTCGTCCATTTTCTCAAATCTAGTGGCCGCTGGCGCTAATCTCCGGACCCAAGTGTCTGGTGGAA
ACACTGCGCTGCATATTGCACTGCAGCGTGAGAACAGACAAACAGCAGTATCGTTGATCAAGTGCGGGTCGAGCATGATGATCACGAACGATTCGGGCAA
GCGAGCGGTGGACTGCACCACGTCTACAGAATTGCAGTTCTTGCTTAAGAAAGAAGCAGGAACTCGTAAGATTATGATCTCGTACACTCACACACATTCG
CAATTCGCGTCAAAAGTTCGTGAACATTTGGAGACGCACGAACAGCTCACTTGTTGGATGGATACGATGGATCCCAGTGGCATTGGCGGAGGTGCGGTGT
GGCGAGAAGAAATCGCGCGCGGCATCAACAATTGCTCGCTTGTGCTCAGCATTATTTGTGATGGATACACCAAGTCTGAATGGTGTTTAAAGGAGCTCGC
GCTAGCAAGGCTTCTTCGCAAACC