Description :
From Genome Similarity Track
Location :
Scaffold_4:1726984- 1730616
Transcript NameFunction/comments
Phyin_T30-4PITG_03427Tyrosine aminotransferase%2C putative
Phyin_T30-4PITG_03428Putative uncharacterized protein

Sequence
3632 bases(100 bases per row)
CGCTCACTGGTGACGTCTGCAGAACTCGGACACTCGAGTGTAGGCGTCCGCAAGAACTTCGTGCGGCGCCGAAAACACGATGCGGAAGTAGTTGGTCATT
CCGAAGCACTGCCGGAACAATAAATGAGTTAGTCAACGTATCATCAACAGCTAACTTACTCAGTAATCAGGTCTAGCTTACCTGACCGGGCAGCACGAAG
ACAGACTCCTCGTCAAGCAGTTTCTGTGTGAAGTCGAAATCGTCCTTGATCTTCGTGAGAACTTCCGTTTGGACTTTCACCTACAGAACCAAGGTACGAT
AATATAATACATTTTAATCGCGAGAAAACAAGACGCACGCGTTGCTCTTGTTACGCACCATCGCGTACATCGCGCCCTGCGGTACCGCCACCGCGAGACC
CGGTATCTTTGCAAGGGTATCGATGGTAAACTTGGCATTGTCCTCCAGAGTTGCGAAGTATCGCTTCTTGAAGTCCACCAACGACTGCTCCTCGGCACTG
CCAGGAACCGGCGTCAGCAAATCTGGGATAGTACTCTGGTGGCAAGAGTCATTACAAAGACCACGTGAGCAGAATTATCAAAAGTATCTACTGTTGAAGA
GAGGCCGGTACCTGGACGAGAGAGTTTGCACCAAGGATGTTCTGTGAGAGCTTAAAGTAAGCGGTACGCACGTCTTTCAAGATATCGTTGCGGTCGTGCA
CCATGACCCAGCCGACTCTCCAGCCAGGGATGAGAAATTGCTTCGCTAAGCCACCCACCGCAACCACCGGAACCGTCTTCGTCAGCGTAGCTATGGGGAA
GAACACGTTGCTCCCAAATACCATGTCACCGTAGATCTCGTCCTACAGGTCGAATGAAACAAATGTGAGTACAATCCACAAGTGAAGAAATGGTAGCACT
CAAAGCTTACCGCGATAATAGGGATCTTGTTCGCCTCTGCCAAGGCAAGGATAGCTTCCAAGTGAGTCTACATAGCAGTTCAAGTGCAAATCATTTGTTA
GTGAGAGAAACCAGCTTGGCAGCTTTAATGACATTGCTTTTAATACCTTCGAGTACACACTGCCGCATGGGTTCGAGGGGTTGTTGACCAGAATAGCCTT
CGTATTTTCATCAACCAAAGATTGCATGTGCTCGAGATCGACCTCCCAGTTGCTCTCCGGCTATAACCATTCAAAAACACACGACGCGTTAGTTTCTCAC
TCGTTATGCAAACCGTTCAGCGTACAAAACGTACCTTGAGGTTGTAGAATCTGCACTCAATCTTGTGCGCTTCACATAGCGCCTGGTACAATGGAAACCC
AGGCTTGGGCAGGAGAATGTTGTCACCAGAGTTCAGAAGGCCTCGTAGTGCAATCTCGATGGCACCTGAACAGCCGCTGGCGATGATGATATCGTCCATT
GTCAGCGGAGCACGCTTGTTTCCAAAGTGCTGAGCAATTGCTACACGAGCAGTTTCGGAGCCAGCCGAGTGAATGTAGCCATTATGCTGCATGGAACTGG
TTGGGAAACCGAGCAAAACATCAGCGTTGAGCTCGTACAGCAAGTAATGTAGTCGTGTATTCGACTCACCGAGTGTTACGGACAACCGCTTGCACCAATA
CATCGGGGCAGTGCAAGTTACCAAACACCGTCGGATCACCTGTGAGTGTAATATAACACCATCATTCAATCGAAAGTTAGGTCACAAACCCAGACATTTA
CAACTAGATTTTGAATGCCCACCTAGCGACAGCGGGATCAGAGTCTTGGTCGAAGTCGCTGGCTTCTTGATGCTATCCACGATTTTCCGAATGGGGTTGG
AGCAGAGGTTCGCGAAGTCCGATGGCTGCACATTCCACTGGTTTTTGGCTTGGCACTTGACGTCAACCACGGACTCGTTGTCAAAAATAGCAAGCTTGGT
CATGTCGATGGGAGGAGCCTGAGTCGTGGAGATTGATGAGGTCAATTTCGAAAATGAGGTCGGTCGAAATTAATCAAGCATGTTGCGTACAATCGTGTAG
TTCAGACGCTGCTAATCTGCCTGTTGAGACGCATCGAAAATTAAAACCCTATTTATTACGGTAACTTCTGTACTTCAAGTAACGTTTTATGCGCGTCCAA
TCACGTGTTGCTTTTCGGTGGTCGAGCGCTTGAAGCTAGTCGAATAGAGACTGGTACAATTGGGTGGCACAGTCTTGGCGGAACTGCGCTTGCTTGGCCA
CAAGTTGTTCCTTAATCGTGTCTTCATCGTCTCCAAGAGCACCAAACACCACGCCAAGGAAATCAGGCCCCAGATCATCATTCTCCCAGCACTTGGTCAA
GATCGCCACCACATCAACACTTGCATTCGCTAGCAGTCTCCGCCACTCTTCTACATGATCAGTTGCTAGAATCTGCTGCGTCTTCACGAAGTCCTTGCTG
TCCAGCGACATCAACACCCGCTCACGATCTGCTTGGTCGTTAGTCGCAAGAAAAGCTGCCACCGCATTGCTTTCGTCTTCGAAGTGGAGGGCGGGGCATA
CTTCTGATGTAGACTGCAAGGCTAGTAGACGGGCCTCGCATTGCTGCTTGACCAGTTCCTCAAGCATAACACGGGTATAGTAAGGCACCATACGCTTATT
TGCGACGAGTTGTTCTCGTACGCCATTCCACCAGTAGTTGACTGCAATTGTGAATTCGTCAGAGTCCACCTGATGCCACCAACCCTCGGGAATCACAAGT
GCGTCTGCAATGGGATAATCAGCGACAGGTTAGTCGACAAAACCAAGATCGTATCCGCTTGAGTGATGATAAAGTGGTGCACCTCCTGCCGCAACCTCGA
ATCGTTGAGCCGCTGCCTCGGGAAATCGCGGGTGTTTCTCGAGGTCGGGTTGCACGATGTTGACTTGGCTGTGATTTACAGACTTGGTATGCACTGGAAA
TGGATACAGCTTCTCCGTTTCTGACGGAGGGTACAGCGTGACAGTCTTCTTTCCGTACAAAACTACCAGGATGTTATGGTACGCGTCGTAGTGTAGCGTT
GTCCGGCCCGGTCGCACAGTCATCCACAAATTTACTTGCGTGACCGGCTTGTCTTGAAGACACGTTGGTCTACCACGTAACGAACAATAATTAGTCAGAC
ACTGACTATAAAATCCCGGTCGAAACGCTTACAAGAGGAAATCGTTCATAATTTCTGGTAGAATCGCTTCGGTGCACGTTGCAGCAGGCTTGAACACTGC
AATGGGGCACTGTGCCAGATAAAAATCAAGGCCATCCACCGTTTGCAGCCAATGTGACGCTTTAGTGAACGATGCTTGATAATAATCCACGAAGTCCCCA
AATTTGAGCTCCACGCTCTGTCTGTTTTTCTCGTTGCCGGCGTAGCAGCCACTCGACCGCTCTTTGCAAGCAATTTCTACCACTAATAACAGGACACTCC
ATCAGCCTTACATGTACTTCATTTTCCCAAATGGCCCTTTATTCGAACCGGTATCACGGTGCAACGCATAGGAATCCAGCAGGTGGATAGATTCAGGTGT
GAACTTCGGCAATTGCGTCGGTTCCACGCACTGACCTACGAAGCCTTCGATTAACACCGCATCGTGTGCATCCTCCATTAGCACAATAGAGTCTATTGTA
CTTTAAGCGTTCCTGATGTGGTGTACACAAAC