Description :
From Genome Similarity Track
Location :
Scaffold_31:172680- 177027
Sequence
4347 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACTTCCACATGACAAGTTGGATGCTGGT
TCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGGTATGGTTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGCCACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAATTCC
AGCTCGTACGCAAACTCTCCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGATGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTTCATCTCTTCTGAAGCTTCTAGGGGGTCCGCCGAGTGCTC
GTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAGGCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAATGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGTGTTTCCTTCCTTGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTTCTC
CGCGATTTCGTCCCAGTCTTGCTGTAGAGGGTCTTCCGTGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGT
GGACGATAGCTCAAAGTCGCCTGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCGTGCCTTATTA
ATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAAT
CATCGTTGTTGGTACCACAAACCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAC
AATACGAACCGGTCAGCATATTTCCATGCATCTCGAGCTTCTTTGTAACTCAGCTCTTCTGCTTCGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GCTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTT
GTGAGGGATGGTCTGGCAAATCTTCGCTGAATGATCTTCGGTAGAACGTCTCTCGTCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTC
GAAAGTTTTCCACTTTGAAGATTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCCGGTTCGTAG
ATCATTTCCTGGATGCGATTCAGCGATGCCAATTCCGACTTGCGAGTTTGAGCCAAGATGACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACG
AATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGT
TTCCTTCCTGCATGCGATCACCCCTTGTGATTGTTGAATCGCGAGCCTTGAATCACCAACGATGACTAAATCCTCGGCACCGCGCGCAATAGCAGCCTTG
GCACCGTTTATCATTCCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACA
GCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATCACGAATCCGCTGTAATTACGGGAAATCCTGGCGTA
CAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGAC
TGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACAGCGAACTGAACCGCGCGTCCGAAGA
GAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGTTGGACGTAACAGATCTTCAACAGCAGAAG
TAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGCTCT
TGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACAC
TCGTCTTCAATTTTTCGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGC
GAAGTCCTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGATACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGCCGCGAAC
TTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATGTTATGCTACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCC
GACACTGTGCAAATCTTGCCAGCAATCGGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGGAGCAAATATCATCCACAAACGACCCGTCGA
CCAAACACAGGGTACCAGCGATGATTCGTTCTGGGTTCCCCGTTCGTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCGTTTGAACGAGCCCTCGGCACTTGGCCCACGACGTTACTTGGCTTGTTCTTCAGCTAAACGCATCTTCTCCGAGT
ATTCAAACCAACCTCCTTTAGGTTGAACAAATCCCCAGAGTGCGTTGTCGATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGGCATGCG
TAACCATTCGAAATGTCCGAGTGCGCAGACGAACGCTGACACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAG
CAGAACCACATGTAGTGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAA
TGCAGAGCCGGATGTCCAGCCCGTTTTTTTTCATCACAATCACGATTGGCGATGCCCATGGACTATCTGAAAAGACGATCAGTCCTGCACGCAACAGAGC
GCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTGATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCG
CCGTAGACTTGCGGCGGCAGTGCGTTACCACTAGCAATCAAGATGTG