Description :
From Genome Similarity Track
Location :
Scaffold_32:17267- 18709
Transcript NameFunction/comments
Phyra_78454Major Facilitator Superfamily (MFS)

Sequence
1442 bases(100 bases per row)
GCGCGATGCTTGCGCTGGAGAATGGCGCGGAACTCGTCCTGGATCTCCTCGTTCGTCTTGCCAGACGTCTCCGGGAGCAGGATGAGCACGAACACGAACG
AAATCGCCAGCAGCACTACGAACGGAAGGTACGCGAGGTCGTCCAGCGCGCTCGAAATGTACGGGTATCCAACGCCCACGATCAGGTTAGCGGACCAGGC
CGTAAGCACACAAATTGAGGTCACGGTAGCACGAGCGTAGTCGGGGAAGATATCCGCGATGACCACATACATGAGCGGCCCGAGACTCACGCCGAACGAA
CCCACATACGTGGCAATGAACAGAATCGACAATGCCGACCAGCTGAACGACAGTGAAAGCGTCACACCGATGGCACTCACGAACATGCCAGCAAGACCAC
ACAGCAGCATACGGCGGTTTCCGAAACGTGCCGCGAAGAAGCCCGACACCAGCGTCGGCAGCATGTTCACGATGTCGATAATGACAGCGCTTACGCGAGC
GTTGCTCAGACCAGCCTGGTTAAACAGATCCGACGAGTAGTAGAACACCGTGTTGATACCCGTGATCTTTTGCATGACGGCTACGCCGAAGGCAATGATG
AACTGGCGACGAAGAGGGGGAGCGATCAGCTCCGAAAAAGGCATACCCTTTCCACTGCGAACAACCTCGTTGCCCGTCTCGCTCCACGTGCTCGACTGCA
TCTCCATGTCGTGCTTGCGCTTCGACTCGATCCACTCGAGAGCCACAGGCACGTTCTCGGCGCCAAACAGACGCGTTAGTACAGCTTCGGCTTCCGCGCG
ACGGCCCTTCAGCAGGAGCCACACGGGCGACTCCACCATCAGGAACGGGGACATGCTCAGGAAAATAGCCGCAAGCACGATCGGGAAGGCAGCAATGTAG
CGCCAACCGTTGTCGAAGTCCATGTAGAAATGAGTTGTAGCAACCAACAGAATACCGACAGTGATACCACTGTGGAGAACGGCACCAAGTAGCGAACGCT
TGTGGGGCGGGGAGATCTCGTTGATGTAGCCGCCAACGTTGCCCGTCGTAGCGCCTGACGCGATACCAGCAAGCAGACGGCCGACTGCGAATACCCACAG
GTTCGACACGACAGCCTGAACAATGGCTCCAGCAACAATGAAGCCACAGTTGTAGATGAGGACCTGCTTGCGACCGAATTTGTCGGCGAACTTGCCGACG
AGACCAGCACCGATCATACCTCCAACAATCCACGCGTTCACGACGATAGTCCACTGGAACTTGGTGTGTCCTGGAAACATGATGCACGTGTCTTCGGCAA
CCGGACGGGCGTTGCAATCCTCAACGTTGTTAAACTTGCGCAGGTTGAGCTGCGAGGTCGACCAACCGAACTGCAGGGGCAGCACGAAAGCGAGCAAGGC
GCTAGTGTACAGGATGTAGGTGGGCTGAACGTGCGCGCGCAC