Description :
From Genome Similarity Track
Location :
Scaffold_481:17266- 21061
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_481-fgenesh-gene-0.8Heat shock protein 70kD
Pytve_DAOMBR484maker-pve_contig_481-fgenesh-gene-0.1Pfs, NACHT and Ankyrin domain protein

Sequence
3795 bases(100 bases per row)
TACATGGACGCCTTGCGCTGGAACGCCGTCGTCGGCTGATTGCTCTCGCTGTCGCCAGTCAAGCTCTCCTCTTCCACCGACAGCTGCACGTTCTGCAGCG
CGACGTCGGGCGACGTCGGGTTGGATTCATCCAGGTCCGGGGTGATGTCGACGCCGTAGAAATCGAAAATGGACTTGGGCGACACCTTGACGTCCTTGTT
GTTGATGTCGTTCATGTACGCGTCCTGGGTGAACCAGAACAGCGGCACGATGTACAGCGCCGAAAACACGTCCAGTGTGTAGTGCTTGCGCGAGGCCACG
ATCAGGAAGGCGATCGCGATCTGGAGGCAGATCATGACCGTGATACCGTACTTGTTGGGCCAGTACTTCCAGACGCCGAGGATGAACGACATGGTGTAGA
TGGTGTGCGAGCTGAACATGAGGTCGCCACAGCCTGAGGTTCACAACAGCACCGGTCAGTCGATCGCACACGCCGTATACACCGACAACCTCCACGACGC
ACCGTTCAAAGAGTCCATGTTGGTGAAGAACTCGCCAACGCTCGGTGGGTTAAAGTCCGGGTTGGGGATCACACACGGCACCGGGTCGTCAGGGTTGGCC
GCCAGGCACGCGTCGTTAAACTTGAGCTCGCAATGCGCCGCAGGAGACGGCAGCGCCGTGACCAGGAAGGAAATGATCCGGAACACGAGGCAGATGCTGA
TGTGCAGCAGCAACCGCTTGCCGACGATCACAATGTACCGCGGCTTGTTCGGGTTCGTGCGGAAGAGTGCGATCGAGACAATCAGCAGCAGTGCAGGCGC
GAACACGCCCGCAAACACGAGGATGTCCGAAATGGAGGCCGCCGTGCCACTGCTCACAACGACACCGGTCAGTTCGGCATCATAAGAGCGACGAAAGCAG
CGAAGAAAGCGTACGTGAGCTCCGGCATGATGGAGTAGCCGACGTCATGGAGCGTGAACCGCTGCTCGGTGGACAGCACGTTGCCCTGGACCCAGTAGGC
CAAGTTGTGGAAGACGCCATGCACGTCTGTGACGACCAAATCAGCCCACACATCAGCATCCTAGCGACATCGTCCAAAGCACCCGCGACCTGCAGACGAA
CGTACACTGCATGATGACGCACGGCAGGATGACCTTCCACTCCTTGCCCAGCAGCTGCATCTCGATCTTGAAATACGTCTTAAAGTTGTCCCAGCTCCGC
AGCTGGAAGCGCTTCCATGGCGTCGTCATCGTAGCCGGCCGACGGTCCCCAGCGAGCGAGGAGCAGGCGGTGCGAGGCGCTACGCGTTACAAGGGTCGAC
GGACGCCGCACAGCTGGTGGTCGCGCGCCAGTAGAGGCTGCGAGTCGACTCTTTGAGGCGGCGACGGCGGCAGCTTCGTCCCGGTCGGCGCAAACCACGA
AATGCAGCGTCGCCTCTTCCAGCGCAGTCGCTTGAGTTCATGAGAGCGAGAGTCGAGTCCCCTAGCCCCAGTCAGCATCGCCAACGCCTACCATCCCTTC
AAACCCGATGTCATGTCGCGATATAGTGGCAACGCCTACGTAAACGCATCTCGCAGACCTGTACAATTGTTTGTCAGTCGTAAATTTGATGAGGGTACAT
TATTTGCTGTGTCGCACGGTTCGGAGATAAAGTTTGAATAATCCAGGAATAGCCGTGGGTCGTACACCGAGCTCGACTAAAACCCAATGAAATGCCGACG
GGTTATTTTTGGAACCCACAGGCGGCGTAATCAGACCGTCATCGTGCAAAAACTCTCGCCAGGGCGGAGCAACGTTCAGTATCCGTCGCTCGATTGGACC
GGCCGCCACCTCGCCCACGATCCTGCCACTTTGCGATCATGTCGCTAAAGTTGGCCGCTCGCGTGAAAGAAACCCTTGCACGCCGCCAGAAGACTCCTCT
TAGTCGAAACGAAAAACCCACCTGGTGCGACACCTGAAGCCTGCTCCTCGTCTTGCCATGGTCAAGAATGGCGGTCGAGGTTGCGACGAGGAACAGGAGG
AGCAGGAGCTCGGGGCCGGCCTTCAACTCGCTCAGCGCCATCGGAAAATCCAGGCCGGCAGCTTCAAAGGCCGCTGCGTGTTTGAACCCGAGGCGGCGCA
CCCTGGTCGCGTCGGCCAAGCCGCGCTGACCTTCACGACGACAGGATCGCTCGGCCACGAGAGCCGCATCACGTGCGTTCTGCCAGCGCACGGCTGGTCC
ATGCCCGAGGCGCCGAACGCGACGCTACAACTGCGCAGCAACGACGCAACACTCCCACTCAAGGCGAGTTGGACAGCGGCGACCCGAGTCATCGAGTTTA
CACTCCCTCCCGATCGTGTTGTGCCAGCGGAGAGTGCTGTTGTGATTGTGCTCGCCGGTGTCGCGACGCCAGAGCACGCGACACCCCAGGCCGAAGCGAC
CGTGACTGCATTCGAAAAGCTGGTGATGCGAAACACGGTACCGCCGTCGACTCGGGGCGGACAGATTATCGATGGTCCGAGAGCATTCACGATCCCAAAA
ATCGTTCCGGGACAGATCGGAGGAGAACGACGCTGGCTGCCGTTCAACTGCTGTCCTGGAGCCATTTCCGATGTCTCGGTTAGCTTCACAGCCGCGGGCA
AATTGCCGACTGGCGGGATCGTTCGACTGGAGCTGCCTCATGACGGCTGGGACATGGACGACGTGCCTGTTGTTGGTCTCAAAACTGGAGTGGCCACTAG
GGCGATTCTTCCTGCAGCATGGGATCGCATCCAACATGTCTTGGAGGTCGCGCTCTGCCAGGAGAGCGAACCGACCAGCATGGACATGCGCGTGACGCTA
GTGGTTGACCAAGTGAAGAACCCGGAGAAGGAGTCGATGCACCTCGGCGAGAGTAGGGTTGCCGGCCGCATCACCACGCTCTCGTCGAGTGGCGGCGTCA
TCGATGGACCGACCAAGCTCGACATTGCATCTATTAGTCAACTGCGAGACTGCGACTTCACGTTGATCAAGTCCGAGTTGGACAAGGAACTTGCTTCGAG
TGACCGTCCTGATGCAATTCCGCTGTCAAAGCTTCCAGATCTATTTCGTCGCGCTGGGTTGAACTTATCGGACGAACTGTACCAGCGATTAGTTCTCGAC
GCCTTACCTCCTCAGTTTGTTGCCGAACCCTCGACTTCCGACCAAGAGGCGAAACCTGCCAATGCTGCAGAGATATCCGACACGTGGGTTTCCAAGGCTG
AGGTGCTTTCTGTATTCGCGATGGCGTTCGCTCCTGCATACAAGTACGGCCAAGAGCTGCGCGTCGCGTGCAGTCGTGGACAGACAGAGCTAGTGCAGGA
GTTGATTTGTCGAGGCTGTGATCCGAGTAGTGCCGACGGCACAGGCTGGTCGGCGTTGCACTATGCCGCCGAGTACGGACAGCTTGCCTTGGTCGACCTC
CTCGCGTCGTTACTGTCTCAACAGCAAGATGATTGCGGTGGTTTCACATTGCCAATCAATGCACGTGACGTCAGCGGGTGGACGCCGCTGCTGTGTGCCG
CTTCGAACGGCTATTCTGCTGTGGTTGAGCGGCTGATTGCTCTTGGAGCCGACTTATCGATCCCAACGACAGGCGGCAGGACCGCCTTGCACTGGGCTTG
TATTCGAGGGATGGCCGAGACCACGCGTGTTCTGCTGCAACATGGCATTGGCGTCGACCTGCAGGATCGGAATGGGTGGACGGCAATGCACTGCGCGGTG
TTGCACGGGAACTCTCCCTGCGTGGACGTTCTCGTCGAGCACGGTGCTGCCCAGGATATCAAGGATAAGTTGTCGTACCAGCCGGCATACTACGG