Description :
From Genome Similarity Track
Location :
Scaffold_482:17264- 18814
Transcript NameFunction/comments
Phyag_g6076hypothetical protein PHYSODRAFT_301465

Sequence
1550 bases(100 bases per row)
CCTACACGGCAACAAAGGCTAGCTGGAAGGAATCAGCAGGGACCGAAGCAGAACGGTGAAATGATGAGGGATAATTATTGTAATACAGAGAGAGGTGAAT
CCGCTGAGTCgcgtggtggctgctgtttGGCGTGGTGTTCGCTTGCAGACCATGGTTGCCAATGCGCAAACACACAAGGGACATCAAcgcgacgtggacg
agaaaGTATGCGCATCTACGAGTTACTGGATGAGCTCTTTACATGCGGATGATGGGCACCAGACCGCGCAGCTTCGAAGCCCCGGTTTTCACGGCATCGC
TGTTGATTTTGTTGTAGCGCAGGTCCAGCACGCGAACGCCCGTGAGCATGCTGATGTCTGTCACCTTGCAGCAGTCGGATAGATTGAGCTCGTGCACGTT
CCGCAATGCCGACACGTCCTCGAGTTGAGTGCAACCAGAGAGGTTGAGCGTATGCGCATTGGCCAACGCAGATACATCTTTCACATTGGGGCAGTGGCGC
AGTGACAGCGTGTGGACCGATCCCAGAGCCGACACGTCCTTGATACCGGGGCAGTAGCTCAGATCCAAGTCGCGAGCGTGTGCGAGGGGTGATACATCAA
CCAACTTGGAGCAGCCAGCGAGTTTCACGATGCGAGCACTTTGAGCAAGCGGTTGCACGTCTTCAAGGGCGTCACAAAAGCGCAGATccacttcttgagc
gccggTGAGGAAGCTAGTGTCGCTGATGTGAGGGCACCCAGACAAATTCACCTTTGTcagtgacgctgcagacgctgtcAGCACTTGAATGTCCTCGAGT
TCCTCGCATCGGTACGTAACGATCGTGTGCACTtgacgcagcgacgacccCAGCGACTTGAGGTTCTTGCAGAAGCTCACGTCGAGATCACGAACACAGG
TTATACCATCGAGCGACGTCAGTTGACTGCATCGAGATAGAACAAGACGGTCGAGTGGTGGCAGGTGGCTGAGCTCAGAGCTTGCAAACCCTGTGCAGCT
TGAGAGGTCGAGCTCACGGAGACTGGAGCTTGCTCCCAGCGCTGAGAGATCCGTCACCGCATCACATTGGCGCAGCGATAGCTCGCGGACACCGTTGCCG
AGCGCAGAGATATCGTTCACGTATCTGCAGAGAGCGAGCTGAAGATTGGGGACGCGTCCAAGGGAGCTGACATCCGTGACGCCGGAGCATCCGGTGAGAT
CCAAGTCTTGTACGCCACCCAATGCCgacacgtcgacgacgcccgAGCATTTGCGTAGCTTGAGTGTGTGTACTCTTCCGAGAGCACTTACGTCGCCTAC
GTTGATGCATCCTGAGAGGTTGAGCTCATGGACATTACCCAGCGCGCTCACGTTGGTGATATTCGCGCAGCCACCGAGATTCAAGTCGTGGACGGTGCCG
AGTGCACTCACGTCGTTCACCTCTGGACAATTACGAAGACTAACGCGACGCACATTACGCAGCGGACTCACGTCATTGACGCCTCGGCAGACGTTGAGCT
GCACTGATTCGCATTTTTCTAGCGGGGTGAGATCCGTGACAGCGTGGCAG