Description :
From Genome Similarity Track
Location :
scaffold_22:17261- 26778
Transcript NameFunction/comments
Pl_112010GPN-loop GTPase, putative
Pl_112011SCP-like extracellular protein
Pl_112012hypothetical protein PHYSODRAFT_258337
Pl_112013conserved hypothetical protein
Pl_112014hypothetical protein PHYSODRAFT_380280

Sequence
9517 bases(100 bases per row)
CACCACGGCAAACAGGACTGCTTGAAGTCGCGCATGGAGCTCTCTATCGCTGGTAGTGGAGAGCCAAGCAACATGCAACACTTGAAGCGGTGACAACCTG
TCAGACAGCGCCTAGGCGACCGTCGTTCGGACGGCGGTGCAAAATGTATCAGTAACATGTCATGCGTTTGTGTTTTCAACTTGGTCACGTTTTGTGCCAT
AGTTTGTAGATGTTGGACATCTCGTCTGGTGACTCTAGATAGTGAGACCTATTATTCGTACTTAGTCAATAACCTACTGTACATATGGCACTCTGGCTGG
TCATCGTTTCGGAAGCGACGGAGGAATTGGAGCTCGTCTATCATGCGCTGTTGTCAAATGGTTATGGGCCCTGCGGGCACAGGCAAGGTACGGTGGCAAT
ACGTCATTCTTCTCCAGTGTCTTGTCTCTCTGTACCAGTAGTTTGAGTGGATTTTGACCCACGGGTGGCAATTTGTGTGCCGTTTTTCGATTGACATGTG
CAGTCCACGTATTGCAACAACATGCACGAGTTCTGCGCTGCGTCTGGGCGTATGACGTATGTAGTGAACCTAGACCCAGCTGCAGACCACTTCGACTACC
CCGTGGCCTTCGGTATGCAGCTTGCCATTGAATTTGAGCCAGTATAAGAGGATTTGACGAATTTCGTTTACGATTGCAGATATCCGTGATCTCATCAGTG
TGGAAGACGTAATGGAGGAGCTGGGCTACGGACCCAATGGCGGCCTCATCTACTGCATGGAGTGAGTTGAAAGTTACTGTATTCCGCGGAACTTGAAGAT
TTGCTGACGAATGGAGTTGATGACAGGTATCTCGTGCAAAATCTAGACTGGCTGCAGGACTTGCTGGGCGAGTACAGTGATGAAGATTATTTTATCTTCG
ACTGTCCAGGTATGTGCTATGCCATTGATTGATACTGACCTAGTGCTGAATTTTGGTATTTGTGACTTGTACAGGGCAAATTGAGCTGTATTCACATCTG
CCAGTGATGAAGCAGCTCTGCGAGTCGCTGAAGGACTGGGGTTTTAACATTTGCTGCGTTTACTTGGTGAGCTTACTGCTTTCAACTGCCAAAGTTTGTG
CTAAAGATTTACATGTGTGGGTTTGCTTGAACAGATCGACTCTTTATTTATCGTTGATCCGACCAAGTTCATCTCAGGCGTACTCTGTTCGCTCTCAGCC
ATGGTACAGCTGGAGCTGCCTCACATCAATGTGCTTACCAAGTGCGATTTGGTTGACGAGAAGGAGTTGTCAAAGTACGCTAGCGTTCTTGTATTTTGCT
GCCTATCTTGAGTAATGCGCGGTTTTTAGATGTTAATATCGACTTGTGTGTTTATTGTAGATACTTGGACCCATCGGAAGGCTACCTCCTCGAAAACCTT
GCGAACGCAACCGACCCCAAATGGCGTCCTCTTAGTGCGGCGATCTGCAACGTGGTACGGGGGCCAGTCACATCCTGTGAGCGATTGTTTTACAAAGGAA
AATTAACGTATACTGGTTATGTCCTTTTGATCACAGATCAATGACTTCAGCATGGTGGCCTTTGTCCCAATGAACATTAACCGCGAGGAGAGCATCGAGA
CTGTGCTTATGCATGTGGATCACGCCATTAACTATGGCGAGGACTTGGAGCCCCAGGTATTATTTGCTTTGTTCTTTGCTATCGACTTCTTCTGATTAAT
TTTTATTGTTGTTTCGTTGTCGTAGGAGCCGAAGAGTCAGGATGTAGACGAGTAGAGTGGTGTTTCTAATGCAACGAACACGACTTTCTGGATCGAAGGC
TCTTCGTGTGTGCAACCCCGTACACATTATCATTACTTGTTTGACGCTGTCGCATGCAATTTAATCTTCAAAAACGCTCCGCCCAAAACAAATTGCTCGA
AGCTGATGAACACTTCCCAATAAACTTAATGGGATAGAACAGAGAAAGCAAAACACTTGAACATTCGTTGTCTCTCGATGCATGCCAGAAGCTTCATTCC
TCGTTCCGAGGAGCTATCGAGCTTGAGCTTGGACTTTCCGTTTTTACTTGACGTCATGTTACTACTTGTTCGTTTCCACGTTACACTTAACTTAATGCTG
ACGTTGGCGACAGACACTACCAAGCAACCACCAGCCCCACTTCAGACGTTATTTGTTAAACAAAAGGCGAGAGCATGGGCCCCATAGATCGAAGCTGCCG
CAACCATCTTGGCACCGATTTTTCGGGAGACCCACCGCATTTCACTCTGCATTTTGACCGGTTCCACGTCGACCTCCTTGCTCAAGTCTTTACTCCGAGA
TGACTTTCCTCCAACTACTACGAGTCACTTTTGTGATATCCGCTATCCTTACGACTCTGTGTGCTTCCAATGTGTCTGCCGATTTCGAAGTTGCTACCAA
TGGTAATTCGACCGACAACAACACTCCTCGCTACCTGGAAGAGGAAGCAACCGACTACTACACAGCTATGCTCAACGCCGTGAACAAGGAGCGCACAGCT
CGCGGACTTCCAAAACTTTGCAAGAACAGCAAGTTGCAGAGGGCTGCCCAAGTTCACTCAGCAGATATGGCCCGACGGAGTTATCTGAGTCACACTGGTT
CGGACGGGTCTACCATGGCAAGCCGAGTTCGAGCTGCGGGATACCACTGGAGTAACGTCGCCGAGAACGTTGCCGCCGGACAGACAACGGTGAGCAGCGT
CATGTCGAACTGGATGCAATCCAGTGGTCACAGAGCCAACATCTTGAGCACCAAGAACAAAATGTTCGGTTGCAGCTATGCGTACAGCTCTAGCAGTAAG
TACAAGCATTATTGGACGCAAAACTTCGCGTCGGGCAGCGGCGAAGTCTGCGGATGAAACTAAAGTGCTTCCATGTAGAATTGGTGTTTGAAGTCTACAC
TAAGAGGAATGGGTAAAATAATAGCATTCGTCTTACCTCGAACAAAGCTCGATGGTTCGATGTTCGTAAATTATTCATCTGTTTGGTCTTGTCGTGTCGG
TGCTTAAGTTGAGATGGTCTCCTATACACGCACAGATCTCTATCTAATATGGTAAAGGCCCACACACGGCATTATCTCTGGTAGCGCCCGTGAACCATGC
AGGCCTGACATGGTCTACTCCATTCGACAGACAGCCATGTGACAACATCACTGACATCGTGCCTCCATCTGCTTCAGTTACAGACACGATTGACGAATAG
AACAAGGATACCTTCACCATGACGCTCACCAAGAGATACCATGGGCACCGTACTCTCTTGCTGAAGGTACGTACGTCAGATACTCACATCCGCTCTACTT
CGAGCTTTAATAACATTCCATTCTGCAATTCACCACCGACATCAAAAGTCTCCCAGACCTCTGCGAATTATGCCACGATGCCAGCATTTGTCCGCAGTTC
GACAGCTCTTTTCGTGTTCCTGGTCGTCACGCTGTTTGGTTCGACAATTGCAGCTCCAAAGCCGATCATCGGTACTGCTGTTGCCCAGGAGGTTTCCAAC
TCCACGGTCACAAGAGAACTGCAGACGTATTCCGCGACTGGATTCCAAGCTCTCATGCTCACTGCAGTCAACAAACAACGCACCGCTTACGGACTATCCA
AGTTGTGCACAAACAAGAAACTGCAGACAGCAGCGCAAGGTCACTCGAACGACATGGCTGCCAAGAATTACATGAGTCACACAGGATCGGATGGCTCGAC
GTTGTCCCAGCGGATCACTGCAGCAGGCTACAAATGGAGTGCTTGTGCTGAGAATGTCGCGGCTGGACAAACAACAGTGGACGCGGTGATGACAGCGTGG
ATGGCGTCTAGTGGGCACCGCGCCAATATCCTGAGCACCAAATACACAATGTTTGGGGTTGGCTACGCGTACAAGTCAAGCACGACATACAAACACTACT
AGACTCAGGACTTTGGCTATGGGAATACTGAGAGCTGTTCGTAAATGACGTAGCGTCGTCTTAAATGGAGCAACAGCAGCAATGGCACCAGTAATTATAC
AAGAGAACTATCGAGCTGTCAGTTGTCGTGGAAGTTGTGCCTACTGCCAAGAGGGTCTTACACTGTTTCAATTCTATCTACCCCTCTAATTATAAGCATC
ACACGAATGCAGAAGTAGTGATAGTTTTCGTGGTTTGTAACAATGCATACCAAGAGTAACGAGACTGACACGAGCGTGGAAGAGCAAGTTCAGCTACGAC
GAGTATTTCGATTACTGGCGTTTGACACTCCTCTCAGACGACTAGAGCACAAAATTGGGGTAGGATCGATTGCAAGATGGTTGCCAATGTCACCACCACT
GACCGTGAATGAGTTGTCATTTACACAGAAGCTATCACCGAGTGTGAAATCCCCAGAGGTAGGTTGCACCCCACAATGCGGTAGTCGTGTTACTGAAAGA
AGCATGATGACAGCGACAAGTTTCGCGAGGACGAAACACAAAACTTGAGCAAGATACAAAGCGTGATCATTACGTCAAAGAGAAGCTCAAATTCCTCGCC
ACTTTGCAGGATGAAGTGAATCTCGGTCGCGAACTCGTCAGTTCCAAGTATCAGATCGACACAAAGGCCTTGTTGACGATCTACGAGCAACTCGGTTATC
CTCTCTCTGGGCAGGAAAAAAGTCGACTGGAAGAGGTGATCTGGCAGGTGAATGATAACCTGGACGGCGCGATCTGCTTTGAAGAGTTCGTAAACAGCTA
CGTGAGGTCTCGCAGCGATCGTTCGGGTCTCGAGCCGTCCGAGATTTTCTTCCTTACGTGCTTTCTCATGCTCGACAAGGAGTGCTGTGGCAGAGTAAGT
CTACTACTTACGAATAAGCAGCCTAATAACGGTATTCGTGTTATGTTCGAGTTAGATTTCGTTGGATGATGCAATGGGCATACTGTGAGTTGATTCAACC
AATCCATCGAGCTCCAAAGACAAATGCGCTGAACCTCACTATTTGCCACAGGTATCTCAAATACGGTGAGGCCATGGAGCGCGAGATGGAGATTCATTTT
GGCAAATTACTGGACGAAGGCGCCCACTTCGTCACCTTCGTAGAGGTGAGTTTCATTTCCCTCAAAACTCTACTCCGACTTTAACATTCGATGGATAGTT
CCATGAGGCCACAATGAAGCGTCTAGGTGAGCTCATCGACCAGCAAGCACCTTTCGCCAGACAGAATAAGTTCTGCAAGAAGCTTTAGCTTACTTTACCA
TACACAACACAACGTCAGGTACTTAAGAAATGATCTGATGCAGCTGTCGGCTGTTTGTACCTGTATAAGTATACATCATCTCATGCTTGTCAAATCTCAT
TCGAAGATCGTCACACCAGCACCAAAGTAGCAATGCGTTGGGGGATTATAGGTCTGTTCCTACTTGTTAACGCAGCAATTGAGAATGGTGTGAACTCTCA
ACCATCGCCCCTATCGCCGAACTTGTTCGACGAGTGGAGAGCGGGCTATCGTGTGAGAGACATTGTGCGAGAAGAGCCTCTGGAAGACCAGATCGCTCGG
TATACGCGGGAAGGTCGATTCCCCAAGACTGGGCGATCACTGCAGGAGAAAATCGACGATGCCAATGAATTTCTAGATCGAGAACTGGCCGATTCCCCAA
GACTGGGCAATCACTGCAGGAGAAAATCGACGAGGCCAATGAATTTCTAGATCGAGAACTGGCAATTGATAGCCAACGGGGTGTCGGTGTGATTGGGCAG
TCGTCTATCAGGACAAAGTGCTGTTGAGCAAGGGGTATGGTCTTCGCAAGGTACGGGACTCAGTCACCTGATTGTGTTGGTTGGTTCGAGTTGCTGACGC
AGATGTGTTTAGTCCGATGACCCAAACAGCAACGTCACGAACTCGACATTGTTCCAGATCGGATCGGTGTCGAAGACCTTCATCAGTCTTGGTATCGCGA
TCCTGGTGAGCAGCGAGTTGATCAATTAATTACACATGAATATCTTCGGATTGCCTAACTAAAACTACAATGACTAGGTTGAAGAGGGCAAGTTGTCTTG
GGATGACCCGGTAAAGAAACATCTCCCGTCATTCCGACTTTACGACAAGTATGCTGAGGAGTACGCTACGGTTGGGGACTTGTGTGCCATGAATTCAGGA
CTGAACGGACTCCCTGACTTTGGATCATTTTTCGGGATCTACCCGACCGAAGAAGACCTCGTTGCAAATCTAGCTTTTATCGAGCCAGCGCACACGCTTC
GTGGCGGTCATGACTACGCGAACGCAAACTTTGCTGTCCTTGGTCAATGATCGAGAGCGTCAGCGGAAAGCCATGGGGTGTTTTCCTGAAAGAAAGAATT
TGGGACCCGCTAGGAATGACACGCACGTTTCCATCAGCTTTTGACGCCGAGCGTGGCAATGATATAAGCTTCGGACATTTCGAGTGTGGCGGAGATGTCC
TTGGACCTTATGACCTTGTACATGATGAAGAAGCACAGTTAACCGCTCATGATCAAGGTGGAAAAACTGCTGCTGGATCCATCCTATCCAGCTCTGATGA
CCTCGCCATTTTGCTTCGGCTTATTCTGAACAAGGGAACGGTGGACGGTGTCACCATTTTGAAAGATCCTACTACAGTGGCGAATATGATCACGGGTAAA
TATGCCGTCAACAAGGAGTTCATCGATATGTTCTTGATTTCAGGGCACCATTATAACCCTGAAGGGAACACACTCGCCTCTGGCTATGGCTTTGATTTTG
TTGGACATGGACAATGGGGCCACGCGTATGTAGACAAGAGTGGCGACACAGCAGTGCATGTAACTCGGACAGGTTTAGCTCCTGATGCGCAGCTTGGTGT
GATGTTTATGAGCAACACCCAGACACCAGAAGGACATCTTTCGTATCCACTTGATCACATACGCTCGTATGTTATGGGCGTGTTCCTCGACGTACCGAGG
GACATATTGGACTTCGCATACCATGTGTGGCGCAAGAATGATAAGCTCATACCGATCATGGAAGGTGTACACGCTTGTGGTCTCCGATTCTGGGAGAACC
CAGCGTATCGCTCTCTTAGCGCTGTGGCGAGGTCAAAAATGGTAGGAAAGTACGTGACTCAATCCTCTACAGAATACTTTGGTTCGTTAGATGTGCGCGA
AGAAGGTGAAGAACTCATCTTGGCCTATGGAGTCCTGTCGGCCCCTCTCAAGTATTACACTGATGAAGGTAGCAAGCGCGTTTTTGTGTGGGACTACAAG
CCTTCACAACTTCTGATCAAGGCAACAAAAAAGGAAGACAAGTTTCAACTAGAACGTGGTGTTGTGTTTCGTCAAGAGTAGCTACTGGTGCTTTATATCC
AAGACGACTCGAGGGCAGAATCGCGCCTCAATTTTACAATGTCTTATGCGTAAGTTTCTCGATCAGGAAATCTAACTTTTTCTCAAGTTTGTTCAGACGA
GCACTCACTTTCTTGATATCCAAGTCCTCATCATTGGAATCGGTAAAGCAATCTCGCGTGTTTTCTATCGGTGTCTTGAGTGTGCTCCTTGTTATCCATG
TACTGCGCTGACTTGGTCTTTCAACCGGTTCAGTTTCTTCCGAGGTAGGACAGCAGCTTTGGTTGATGTATTTAGTAGTGAGATGCATCATCGTAGCCTC
ACACTCCTGTATTGTGGCTTCAGGGAACAATGTTTTAAGAAGTCCCGCTGTAACCTTCGTCTGCGGTGACCAGTCCAAAGGCATAGCAGCTAGCCTATCG
GTTAGTGCTTCTCGCAACACACAAGACCGGAGTCTTCCCCAAAAAATCACGGAATGCCGTCGACTCGACCGCCGGCAAAAACAAAAAGATAAAATGTGAC
TTACTGGAGCGAACCAGTGTCGAATTACATGGTTGAGCACACGACGAAACACCCAGCACTTGCTTTTGTCTTTCGTATCTTTCTCCTCTTTGTAAGCATC
CACAACAATTGCCAACACAATATTGAGCAGGACAAACGTCATCAATGCCATGTAACTCCAGTAGTACGCAACGGAATAGTTGATCCTGTCGATAGTCTTG
ATATCGAAGTTGTTGAAAAGCATATTAACGCAAGTTTTGGTTGAATTGAGCAAGGACGAGAACTCCTCAACGCTGCTACCAAACAAAACCGTTCCTGTTG
AAGCGAACGCTGTGAAAATCACCACAAAAATCACTGAGAAGGTCCGAAAGGAGCGAACGGCGCTTGCTATAGTACGTGTGAGAATACTCAGCCCAACATG
ATCTCGGAAAGTGTTGAGTACACGTAACCCAAGCACGAACACCGCTGCTGTCGCAAGAAGACGCAGTAATACTGTGAGATTAGCGATGTGTTGGAACGAG
CTCGTGACCGACGAAAGTGCTGCCTTGACGTCATTTCCACTCTGACCGGCGTCTCGTAGTGTCGAAAGTTTATCACGGAATGCTGCATTGCTCATCGCTG
ACTGAGTGATGAATACGGTAATATAAAATGCATATACAATAGGGCCTCGTAATGCATCGATGGCGAACCAACCATCCGGAAATGCCCAGAAACTGATCGC
AATTCCGGCGTGCCTAAACAGCTCATTGAGATGCCGACTGGAAGACTCCCGGCTCATATTCTTATATCGCACCACGACTGAGATCAACGCTGAAATCAAC
ATCCACGGGAAAAACCACAGCATCACGAGAATATCGAGCACTATTGTAGTTGAGTTCGGGAATTGGTCCAGTAGAGTAGACGTGGTTGAGTAGCTCGGTT
CAATGTAGCCACCAGCGTTGAAATCTAGCTGGAGCTTCGTGATCGCGTACCCCGGCAACTCGCCATTGATCGTAATGATCGTGATCAGTAATTCCTGCGT
AGACAAATCTAGCCAATCTCCACTCGTCTTCTTCTTGGTCAATATCGCCCTTGCCTCCGTTGAATTGGTGTCGAAAGTTATTAGCAATTCTTCAGTTCTC
GTAGTGGAGTCATCGTAGCAACTCGGGTACAGCTTCTCGAGAAAATCGGGTGTGTTACATGCGTCCGATTCCATTCTCGTCACCCTGAAGCTTACAGCAC
CTAGAACTCTGTTGAGCGAACCAATGCTACCCCATTCATCTTCTGGAAGCACCTTCCCGTTGTAATCCTGCGTAACGAAAACTCCTGGAGCAAATGTATT
GTTTAGCCAGTCAAAAATGTCGGGAACGGTGTCAATGTCCATTAACTTGATAGGAACCTCTGTGGACCGCTCTGATGCTAGAGACATCCCCTTGCTTTGG
TAATACATTTTGGTAGTCGGAATGTGTAGGAACATGGCGGCGACGAAGATGCAGAAGGATACTATGGCGACGATAATGTCCTTCATGTCAGAAGCATGTT
TTTCGTCGCGCCAAAGCCTGGCGAGAGCTTTACGGACGGGAATTTCATGACCTCCACATATCTCGGAGCTGTCAACATCATTTGCTTGATACTCGGTATC
GATCTGAGTGCAGTCGTACTGGTCAGGCGAGAGAAATAGATGCATATCTGCTGCTTGTACCATTCCTTGAGAACTGGTCAGGATGGGAAAATGTATCTGC
CATTGCGCTTATGGGAG