Description :
From Genome Similarity Track
Location :
Scaffold_53:172594- 174493
Transcript NameFunction/comments
Phyin_T30-4PITG_17255Putative uncharacterized protein

Sequence
1899 bases(100 bases per row)
GATATGCGCCGACGGCGAAGGTCCTCAGTTCCTCCAAAACAGCGTCAGTGGAGCTCAGGTCAGGGCACACATGCCGATCGACCCGTCGGTCAGCGAGCAG
CTCAGAGGCTTCGAGAGGCGACGCAGAAAGCTGCTGCAAGCGGCGATTGACGCGGAAACGACGGCGGTGGCGCTCGCCACGAAACAGAAGGACATTCACC
AAGTTATTTCTCGTTCGCCCGCATTAGTGGAGTGTTTGGGAGGTCAAATCGCGGTGATGGTGCCCGCGCAAGCAAGAGCGTCGGTTCTGAGCGTTATTGC
GGAAGCGGTAATGCATGTAAAGGGTGCAGCGACACAAATGGTCATGTACGCTGAGAATGAAGCAAATGATGCGTTGCTCCAGATGCAGACGTGCGCTATC
AACGCAAACACATCTCTTGAGAAGTACGTACGTGATGCAGCAGAAACTAGCCGCATATTTGCAAGTATTTATGACGGTAGAGAAAATTATGCAACTACGA
CAACAAAGCATTTGAAAACCTTTATTGGATGGGAGAAGAGAAACCGGAAGACTTTTTCCAAACATTGGAGGTCTGCCTGCAAATATTACCCTGGTTAATT
CTGCAGCACAGCACCAATCGGCGATGGCAGCGACAGAGAGTGATGCATCTGTTGCTCTAGAGACCCCGGCTCGAGCATCATCCCCTGATGAAGTTGCACC
TGTTCACCGACGCAAGCGGCTTAGGACCCCTCCAGTCACTCCTCCGAGTAGCCCCCCTTCAGTATCAAATTCGTTGGGTGAAGCTGCCCGTGACGTTAGT
GCTGATGTATCCGCCGCTGCACTTGGTGGTGATACATCTAGTGGTGACAATGATTGTGGGAATGAGCCTGGCAGTGATGAAGATCTAAATGTGAGTGAAG
CGATTGCTGTTGAAAGTAACAGCGATGCAGAATTTTTAAGTGGTGGAGAAATGGAGAGTGATGAGTCTAGCAACTCTGACGTAAGCGTTTTCGAAGATGC
CAATGTGGGCAAAGCTGACACAATTGTTTCGCATCGGTTTTTCAGGAAGCGCTTTCCAAAGAATGACGCTATACTAGTTTGGACAGATCTCGAGGACAGT
GAAAATTCTCGAACTGTGCACGTCTTCCCGTCCGATTTGAACAGCTTAGAAGCAAATTCTTTACTGACTCAAACTGCGTTGGATTTTTTATTTACCGCGA
CGTGCCTCGGGTAAATGGGGTAGTTTGTCTTTGTGGATCGGGATTATACGTATTGATGGAGAAAGCTAGACGCACACATAAGGCCGTTACGCAGCAGCGA
TTATTTAAAGATTTGGTCGCGCTGTTCAATTGGTCATACCAATATCTGCTGCTACCTGTGTCTGGCAGGAACCATTGGGGCGTCTTGATAATTGAGAATT
TCATGCACGCTAGGGGCCCACGAAAGTTTATCATGCAAACTCAATGCGGAAGGCTCACAGCTCAGCGTATGCATTTGATATCCTCAATTGCTTTTTGTCA
AAGGTCCATCGAACCAAATCAGATACAGCAACTACTTTTGAATGGAGTACGTTTGTCCAGTCATACCGCGGTACCGCACAGTCACACTGTGGTACCACCA
AATACCGCGGTGTAACTGTGCGGTGCCGCCAAATACCGCGCTGATACACTGCGGTACTGCGCCGTAGCGGTCACTTTACGATCCCAGACAGTCAAAGGGA
TCCTGGCAATTACAGAGGTTGTCCACGTCGATTGATGCACGTTCGGGTAGCAGTTTGATCCAGTGAGATCCGTGCAATCAGGCGGCTCATCACTTCATCA
TGGATTAGAGCAATATTCTTGGAAAGCCAATTGAGCGTCTTTCTCCGCATTTTACGGCTGTCATCCAGGTACTGCACAGCCAACTGTGCTGCTACTTCC