Description :
From Genome Similarity Track
Location :
Scaffold_196:17259- 18831
Transcript NameFunction/comments
Phymu_g6516Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
1572 bases(100 bases per row)
GATGGAGCTCGCCGCAGAGGtggaagcagagcagcagcgctgggcAGGcgccgagctgctcgtgtgCGCAGTgatccagctgctgctggtcaacgTGGCG
TACCGTATCGACCGCATGCGCGAGGCTCCGCTGCTGTCCACGTCCTCGTGGGCCATTTTCTGCGGCCTGTTGAGCGGAGCATTGCTCGCTCTGGTGTCGA
AAGAGGTGCGTTCGCTTTGCAGTCGTGTGGCAATTGTTCTCGTACTGATTTAGTGATTACATCTCGTTTCTAGCGCGTGCAAGGTGCAGGTCTGGACCCT
CAGATCCTATTCCTTGGACTGCTGCCCCCGATCATCCTCGAGGCAGGCTTCAATACGCAACGCAaaggcttcttcagcaacttcttcgctATATTATTAT
TGGCAATTGTCGGCACTCTATTGGCTACATTCGCTACGGGAGGGATCCTCATCTGGCTGGGCAATTTGGGGGTCATCACCCAGCTCACGTCGGCCGAGGC
GTTTCTCTACGGGTCTTTGATCTCTGCCATCGACCCCGTTGCGACGTTGCTCGTGTTCAAGAAGTGCAGAGCCCCGCccctgctcttcaacttggtcttC
GGAGAGAGCGTGCTCAACGACGCTGTagccatcgtcatcttcacgcTCTTCCAGAAGTTCGTGGAGAGTGGCAACACCGACGTCAACGTCGAAGTAGCCA
TGTCCATGGTATTCAGGCTGTTGAGTATCGGCGTGGGCTCTGTGGCTCTATCTGGAGCCATTTGCTTCTCGTCGGCCTACTTCCTGCGTCACTCGGACCC
AGAGCTGCGCCAACACCCGATCTACGAGATGTCCATCATTCTGCTCAGTTGCTACGCCAGTTACTTGGCGGCGGACCTGTTCGGGCTCAGCGGACTGCTG
GCGGTTTTCTTCAGTGGCGTGTTTATCCGGCACTACCACATGTACAACATCTCCGaggccagcgccttcgcgttcaagcagctgctggcgacgatggcgt
tcttggcCGAGAACTTCATCTACCTCTACTTGGGACTGAGTGTGTTCGCCTACCGCGACTCGCTCGTGTGGGACTGgggcttcatcttcgccaaCTTGGG
TGCGTGTCTACTGGCCAGAGCATTCAACACGTTCCCGTTGTGCTCGTTAGCGAACTTGGGGCGttcggagcagcagaagattCCTTTCACGTACCAGATT
GTGATCTGGTTCTCTGGTCTGCGTGGGGCCATTGCCTTCGCTCTGGTGCTGAATGTATCGACGGGGAACCCCGTCCACGCGGCGATTCTCAAGAGTTCGA
CGCTTTTCCTAGTGCTGTTCACCACGGTTTTCTTCGGAGCGGCCACGGGTCCCCTGCTTCGGGTGTTAGGACTAACTGGTGATCCTCAGCCTGAGCAAGA
AGTGACTGTGAGCCAAGACAAGTTCACGGGCGAAGCTGACGAAAATCAGCCACTGGTGAGTGCTTTGCTCTCACCGCCTGGGTCTCAGAGCGTGCACAGT
CGTTGGGTGGACCTAGACGAGAAGTACCTCAAGCCGATCTTCGGCGGTAACCCGCGTCTGAAGAGCGACACG