Description :
From Genome Similarity Track
Location :
Scaffold_6:1725584- 1727034
Transcript NameFunction/comments
Phyin_T30-4PITG_04646ATP-binding Cassette (ABC) Superfamily

Sequence
1450 bases(100 bases per row)
CAGTCTGACCTGTCGGCACGGTGAAGCTCACGTCCTTGAGGCCGTTAGCTACTGGCTGGCTCGGATATCTGAAACACACATTGTGGAACGACACGGTGCT
GGCGGTCGGGGAAGCCTCCAGTGCCGGTGCGTTTGGTTTATCTTGCACCTCAGGTTGGATACGCAGCAGCTCAACAAGGTTTTCTATATCCACAAACGAC
TGGACGATGGTGTTGTAGATGTTGCCCAGCGAGTCCAGCGGCTTGAAGATGTTCGTGATGTACACGGTAACAGCGACAAAGTCACCGACAGTCATGACAC
CGTAGTAAATGTTGCGGGCCGAGATCAGAAGACACGTGCCCAGGCAGGTCTGTTGAATGAGCTGTTGAGCCACCACAATAACGTTCATGAGGCCTCTCGT
GGACAATTGGGACGTCTGGTAGAGGAAGATGCTCGACATGTATCTGTCCAGCTCGTAGTCTTCAGTGCAAAAGTACTTGACCGTCTCGAAGTTCACAAGC
GAGTCTACGGCCTTCTCACTAGCTTGGTTATCGTGTTCGTTGGTTTGCTTCTTGAAGCGCAGGCGGATCCGGGTGCCCATGGCAGTGATGATAACGTAGA
GCACCACTCCAATGATCGTCACGACGGACAAAATCTTCTCCTTGAACGAGAAAATGAAGACGATGGATACGACCACAAGCTCAATAAAAGTGGGAAGCAG
TCGGAAGAAAATGACGTTGACAATGTTGTCCGTGCTCGTAGAGCCTCGGTCCAGACAGCGCAGTACTTTGCCAGTCTTTTTAGTGAGGTGGTAGTTCATT
GAAAGACTGTGCAAATGTCCGAACAACTACCGGCAAAAACAGAGTCAGTAGGTTCTTGGCTGTCGCTTCTATTAAATAGAATGCGGTAATCAATACCTTA
GCGGCAACATCCTGGTACGCGTGCTGCTTCACCACCATATAGAGATACGTCTGCAATTGTTTCGCAGCGGCGAATCCAAACAGCGTGACTGCCCCAATCG
ATAGTATCACAATCGTTTTCGGACAAAGGGGGGGGCACTAAGTAAAGTACGTACGGCAATACATTGCGATTGCGAATGTCGGGACACGAGTGAATTGACT
CTCCGAGATTGCGTTCGTTGCCTCCTTCAGGAACAACGGCGCCAGAATGCGCGACCCTCGTGACAGGAACATGAAGGAGAACGAGACAAGCACACGAAGA
CGCTGTTCCGCAAAAGTTAGCATCACTCAGCTACTAACATTGAAAAAATATCATTGCATCAGTCGTACCAACCCCCATGTCTTCGGCCAGAAATCTGCAG
TCGTACCATTCAAAAGTTCGAGTTAGCAATGATACTCTTAAGTCAATCAAGCTGAGAAGACAAGTCCTACAGGGGATGAGCAGTACGCGCAGCTCCCAGA
TCGTGGCGCCTTGCATAGATTGCGGGTCCTCCAGTGAGGCCGCGGAGTGC