Description :
From Genome Similarity Track
Location :
Scaffold_85:172523- 174955
Transcript NameFunction/comments
Physo_158138predicted protein
Physo_158140PREDICTED: similar to putative MAPK activating protein

Sequence
2432 bases(100 bases per row)
GCCAGTGTAGTACTCGCTCGAGCTGTGGATCTTGTAGCCGAACACGCGCGGCACGTACGTCTGCGTCGGTGGCGGCACCACAAGATGGGAATGCGTCATA
AGGAACACATGCGGGAACGTCGCGCCGAAGTACGCGCCGTCAATCTCTGTCAGCAGCAACACAATAACAACAGCAGCAACCAGTCAGCCTTCACCTCTCA
ACCAGCACCAGAAAGATATGGCAGGCAGACGTACGGCCTGCGCGCTGCGACTTGGGGAAGAAAATGTCGCGGCACTTGGGGCAGAAGACGTTGACGGTCG
TGTGCCGCGGCACGTCCGACTGGCCCACGGGCAGCACGGGCTGGCCCTGGCAGTAGACGCGATGACAGCGGCCGAAGTCGACGTTCTGGTACTTTTCTAA
CATGGCGGCCATGCCCTTGGTGGTCAGGATGTAGCGCGCGTGGATGAGCCCGTAGAGCATCTCGGCCGCGGACTCGATCATCTCCTGCTGGGTCTGCGTG
AGGTTGCTGTCGTTGGGCGTCTCGATGTCCAGGATGATGTCGAGCGCGTAGTCGTAGTACGGCACGATGCTGCTGAGCCCAGTGAGGTTGAAGTCGTCCT
CGATGTAGTCCTCGTCCACCTCGCACAGGAACGAGTTCTCGCGCAGCGAGCAGAACCACGCGATCCAGCTCGTCTCCTCTTCTTCCTCGTCGCTGCCCTC
CACGTCGTTGTCCTCGTCGTCGTCGTCATCGTCGTCGTCGTCCTCCAGAGCGCTCGAGTCCTCCTCCTCCTCCTCTTCTTCCTCCTCGTCCTCCGAGACG
TTGGCGGCCGCGCGCGCCGCCTCGGACACGCGCAGCGTCTCCATGTGGCCAAAGAGCCGCTCCATCTCGGCCTCCTCCGCCGTCTGGCCGCCGTTCTCCG
CGGGCTGGCTCATGGCTGCGTCTGTGTCTGCGATTGCGGGGCCTCTGGGCGTCCTCGCGGGCTCAGAGACACGGCGTCGTATGCAGCAGCGTCTCTAGAG
TCGAGCCCTGCTGACAGGAGAGCGCGTCGACGCGTGCACAGCGAGAGAAGGCGCACCGAACGAGGGCAGCTCTAGTCGCACGTTAGCGATGACGGCCGTC
GCTTTCCCGAGATAGAGCCAAGACCGCTGACCTGCCGATTTTAGTTGGTGTGGAGGTACACCAGGTGTAGCCATTTCGGGGAGGCGACTTGCCATGGCGG
CGGCGGACCGAGACTGGTACGAGGCCTACGCCTCTGGAGAGGAGGCAGCGCGCGGCCTACAGGACGGAGAGGAGGGGTATGAAGAGGAGTATGAGGAGGT
GGAGATCGAGGAGATGACGGACGACGAGCCCATGCACATCACAGGAAGGCTCTTCCTCGGCTCCATCGACGCGGCCAGGAACATCGCAGCGCTGAAGCGA
CAGCGCATCGGTGCGGCGCTTGCGTTGCTCGGCAAGGGGGAGGAGGACGCGGCTGTGTCGACGCACTCGAGCTCCGTGGGCGAGCAGTACGCACAGATGC
AGATTGCCAGGAGGAGCTTCGAGATTGAGGACTCGGAGGACGGAGACTTGCTGCGCAGACTGCCCGAGATACTTGCCGCGCTAGGGAAGCTCGTGTAAGT
GGGTCAAATGCTGCAATGGGCGTACAAGAGATTACATTGAGTGTGCTTGAATACTTGGTGTTGAACGACAACAGTGAGAAGGCAGAGCACGTGTTGGTGC
ATTGGTACGTCAAATGATGAGCTGGCGGCTGCATTCCGGTTTACTGAAGTACGTCGCTAAACGATCATGTGCTTTTTGTTGTTTAGTATTGCCGGTAGAT
CACGTTCCGCATCTGTAGTAGTCGCATGGATGCTTGCTACCGAGCCGAAGCTTTTAACCGTGCAAGACGCTGTTGACCGGATCAGGTGCGAACTATCATC
GAAGACTTTAGGCCGAAGCAGTATGCATGTAAGCTAATGTATTGCGCTCGCTGCTCTCTAGGATCATCCGCCCATGGATTGAGATCAACCCTCACTTTAT
GCGGGATCTCCATGTGTTTCACGCGGTACTCACCTCGTCTGGTTCGACGCCGCTAAGCGTTGATAACGCTGCGCTGCTCAAAAGTCGGTCATTCCCGCGG
CTGGACTTCGGTGCAAACCTCGTCGACGGAATTCTTCGCGGCACGAAAATCATCACAATGCGACTGCTATCGGACATCATGGGCGATCGGAACTCGGATT
TAGGGGGCATTTTCCCGCACTCCGTCGTCGCTGCGACGACTTCAAGTACCGATGGCTCTTCATCAAGACCGCAGTTCGCGTACCTGAGGATCGATCAAGT
CGAAACGCACGAGCTCAACGCCATTGACGACGCCACGCTGCGCAAATCCGGCTTCAACTCGACTGACGAGGTGTTGGCGGTTCTCAAGCAGTTCTACCCG
GACGTGACGGCCACGACACCGCTGCTCATGCT