Description :
From Genome Similarity Track
Location :
Scaffold_262:17251- 21207
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_262-snap-gene-0.15Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_262-fgenesh-gene-0.7Serine protease

Sequence
3956 bases(100 bases per row)
GAGATTCGCCGCATCCAACTGGAGCAACAGCGAGCACAAGCAACCATCCTGAGAACGCTCGAGTCACTTGGTCGAGAGCTGCGAGCGCAGTACAGGTAAC
CATTTTACTTGGTGCAGGGGAATTTGTATTTGCTGGATGCTAACAACGTGAGGCAGGTCATGAATGGATTTTGAGTTTCGAAAAGCAGGTTATGCGCTTG
ATTTATGGTGTTTATGTGTGCCGCTGGTTGTTTTCTGCTGATTCCGTTGCGCTGTTTGTGCCTGAAAGAAGATCCAACCAACACTGTCGCTTTGTTGGCT
CTCTCACTTGTGCATCCCAAGCGGCCGTCCAGTTTCATCCCAGGGCGCCTTCATGCTCATGTCCGGCATACCCTTCAACGACATCGGAGTTGCTGCCTTC
AGTGGCGCGATGTGATGTGGGAGCGACGCCTTTCGTGATACCAGCCCCTCGGACGATTTCGACACCTTCGCCTCGCCATCGCCGATCTTCACGTCTTCTT
CTCGTCGACTCTCGCTCTGCTTCGAGTCTGCGTGAAGCGCACCACCGCCAAGTCTCTTCTTCTGGGCGGAAATGCATTCCACAGACTGCTCGCCATCTTC
GTCAAGGAACTCGTTGACCACTTTCCAGAGACTCAAGCGTCGCAGCTCGGCAAACCCAGGCACGCCGCTGCGGTATGTTTTGATCTGCACGCCCTCCTTC
GAGAACGAGATGTCGGGGAAGTTGGTGTCCAGCAGCGGCTGCTCCTCCTCGCCGTTCTCGACGTACACGTAGAACGTGTAGTCGTAGTACAGCATCACCA
GCACCACGCCGCCAACGTAGATCTTGCTCGCGATCGCTTCGACATCCTGATCATCAACAGTCACGAAAACGAGCGGTAAGCCAAATGATTTGCAAACACT
GAGCTCGAAACTTTTGTACCAAAACTCACCTTGAGCGCCGGACACTTGTCCATTCCGACCTCGAAGAAGCACTCGACACTGTCATCCTCCAGCCATTCGC
CAATACGACTGGCGCTGTCACCCTCAGCCAAGCCCTGAACAAACTGCTCCGCCTTAGAGAGCTCGCCCTGAATCGCAGGGACAATCTCCGCGAGGTGCTC
CATCGATGGCGTGAAGAGCGATGTGGCTGGCATCTTGGAGACTTCGCACATGAAAGTCTGTGATTAACGGATACGGCCTGTCAGTCAGTCTGTTGTCGAT
ACAAGCCAATCGACCGTCACAAGGGAATTAAAAGTGTACCAGTGCACTCTGCTGGCGTCGCAGCATCGGGATGATCACGGGGATGTCTGCCAGCGCGAGC
TTTGGTCCGAGGTCGACGTGGCCGTTGTAGCACCAGTTGCCAAAGCGGAAGAGCACTTCACGCAGGCTCGAGGTGCCAGCATCGCCGTCCACGCGCGGAG
TTCGTCGGATGAGGAACGTCTGGTTGTACCCCGTACCGCTCACGTCCTTGCACTGCACCTTGAGTGGCTTGGGCGGACTCGCGTTCTTGCCCGCCTTGAC
AGCTTGCCAGAGTGTGAGCTTCTTCATGTTGGTGCAATCATCATCTTGGTACGTTTGCAGTTGGATACCTTGCAAGTGCGCTGAGAGATCCGGGAAGCGC
ACGTCCAGCAGCGGCTGCTCGCCGTCGCCCTCTTGGAGCACGACGTAGAAGCTGCGCTGGTAGTAGATCACGAGCAGCACGAGGCCGCGCACGAAGGTCT
TGCTCGCGACAAAGTCGACGTCGTCGAAGCACTCGTAGCCGCCGCTCTGCAGCTCGAAGAAGTTCTTCGCGTCCCCGTCTTCGTCCACCCAGCGGTACTC
CTCCGCCGACTTGATGAGCTTCTTCTCCATGCGTTCGCTCGCGAACTCCGCGCCGATGAAGTCAAACACGTCGTACAGAGTCTCGAGCGGCGCCGAGTAC
GGCGACGTCGTGGCCATGCCTTTCCACTCGCAGAGGTACTGGAGCGAGCCCTGCTGCTTCTGCAGCGCCGGGATGACAACAGGTAGGTCCGCGAGCTCCA
GGCTCGAACTCCCGAGGTCCACCTTGCCTGTGTAGCACCAGTTGCCGCAGCGGAAGAGCACGTCGTGGAGGTTCGTCGAGCTTGAGCGCACGATGTACGT
CTGATTGTACCCGTGGCGGAGCGCGACGACATCCGAGCTAGGCACGCCGGCTTGGTCCACGTCACAAATGGTGTCGTCAAGCGCCTTAAACGTCACCTTC
GCCTCATGATCGCGGTCGACGCCCTTGGCCTCCATGGTTCGTGCTGCTGGCTAGTTGGCTGTTAACGGGTCGCTGACGGATCTCCGGACTGCTTGAAGTC
GCTGGTCGAGGAGAATGCGCTCGGTCGCTCGTTCGCGAAGCTGGGCAAGGGACGCAATGCTGCTGGCTGTTTCAGTTCTCAAGCAGTCTCTCGAGCATTC
ATGCGCCTTCGTCAGCCAAGCTCCTGTGCCAAGACGAGAAGCCAAATCCGGAAATTGGTTTCGTGGCATGAAACGGACGCCAACGCCTCAGGAAGAGACG
GCAATGAGATTGGTGCTGCAGGCAAACATTGGGAAACTTGGTGATTCGATTATCAACACGACTTGCATACGTGAGTGAGGCAAAAAAAATCCAGAGCTAG
CTAGACAAACCAAAAGGCAGGCACTTCGACAGAGTTACCGGATGGCGTGCGTGTGAGTAAGATGACGGTCCCATTACCACTTGTGTGGCGTGGCCCACGC
ACCTGTCACCTCTGCAGGTGGCGCTGGCTCGGATCCTGAAGCCGCCTGGCCCAATGCTGGACCCCATCCGTCGCCTCTCCCCATGGTGGACGTCTTGGTG
ACCGTGGTTTGCTTGACCACCGCCGCACCGTTGCCACCCCAGGCGACCGTGGTCGATGAAGTCGTCGTCCTCGTCGTCGAGGTCGCTACCGTAGCCTTGA
ACGCGCCGGGCTGTTCACGCGCTCGCTTGCCACGGAGCAGCGCCTGGATTTTGATCGCCGCCTGAACCTCCGTGAGCGGCAGCGCCTCGGGGAAGGCTGT
ACCGATCTTCGTGTGCTGGCCGCGGCCGAAGCTGAAGCACTTGATGTTACACAGGTACGGTCCCAATTGGATGTGGTTCTCCTCCTTGCCGTTCAGGAAG
CAGAGCGTGTACAGCGCGAGCTCGAACTCGGGGCTCACACCGATGAGGCTTGTGGACACGGGCTTGATCTCGCGCTCCCAGCTGAATTGGATCGTCACGA
GCTGCTCATGGTTGTACGGCTCCGTGAACGCGCGTCCGCGCTGCTTGGGGCGGATGTACCCGCGGTAGTCCAGGCGGCCTTGGCGCTCCTCGTTGTAGAT
CTGCATCCAGTTGTGGCAGCCCAACACCTTGCCCTATAGTATCACAACCGATACGTGTCAATATACATGCGCATAAAAATGAATTGTCCATGTGCTATTG
GACGTACGTCGCGCTCTTCACCGATGAAGACGTGCTCAAAGCCCGACGAGTCGTTGGTCGCCTGGCGCCGGTAGAGCCCGAACCAGATGAAGTCGAGCTT
GCGCTTGAACGCGCGCGCGTCGCCACTAAACTTCTTGTTCTTCGTGAGCCAGCTGCCATTGCAAGCACGTAGATACAACAATGTTAGCAATCCGCAACCT
TATGTATGATGATAGGCAATGGATGAACGTACTTAAGCACGTAACGCATGGGCGCAGTGTCGATGACTGCGTTGAGGAACGCGTTGTTCTCCTGGAGCTC
TTCCTCGGTCACGTCTTCCGAGATGCCCGTCTGTTGCACGACAAGCAAGTACACAACGCAGTTAGCTTAGTGTACCTAACAAGTGCGTACTTGAGATAGA
GCAGTAGCACGTACGCCGCGCTCGTAGTTGTCGAGCAGGTCCAGGAAGAGCTTGAACGTGCGGCGCTCAAACACGCACGGGTCCACGTACGTGAAGAGGC
GCTCGGTGGCGTAGTCGCCGTGGTCCCACATGTGCTTGCCGTCCTGCAGGTCGATC