Description :
From Genome Similarity Track
Location :
Scaffold_215:17243- 18737
Transcript NameFunction/comments
Aphas_H257_18566Hypothetical protein

Sequence
1494 bases(100 bases per row)
TCGACGTACTCGCTCTTGATCTTGTTTTACGCGCAGCTGTGCACTGCGGCCGTGTACACATCGAGCATCCCCGTGCACAAAGGCATCTACGTGATCTGCA
ACCTGCTGCTATACCTGGGCTTCCTCGTCCTCTTGGCTCTCTGCACGACGTCGTCCATGTTCTGGCAGTGGACGCAGGGCATCCTCGGCGCGTTCTACTT
CCTCGGACTCCTTGCCGTGCTGTACTACTCGCTCCAGCTCATCTTGTTCTTCAAAACGAGTCACCCTGACGACGAATTCTTCTTCGATATGCATCTGCAT
CGTGGGCTCACGCCACGGCAAATCGTCATTCAGCGGGTAAGCGACCCATGTCCCTTCCAATCTACCTTCACTTACGCAACGGATGATGTAGATCATGTGG
GTATGCATCATGTGTTGCATTCTGTTCTGCGGTCAAAGCGTCTACCTCGTTGGCATCGCCACTGGACTCGTGCCGTCGATCCATTATCGGACTCCCGCCG
GGGTGTCACCGTACGCGTTTGAAGTGGGTTTTTATATTGTAACGGAATTCCTCCCCTGTGCGCTGCTGCTATGCTTCACCCGACGGAACCCCCTCAACGA
CAACCCCCCCCACAAACTGGCCGATCATTTGGACCATAGTCTTCTACTCCCTGAGGCCAGCGGATCCAACCGCCCTGACGAAGCATCGTACCTGTATCAG
GTATATATATATATAGATTATTGGGGGTTTACACCGAGATTTGTGGGGTACTAGAATCCACCCCGGCCGTATTTTCCGCGAAACAACAGCAGCGGCGTCT
TTGACCGATCTCCCGCCGCGGCATCAGCCACCAAGTCGGCGTCGTTTGTCTAACTTAACGAGATGTTTGTTTGCCTGTCAAGAAGCTTGTGATATACTAC
CGTATACCCCCCGCTTCAGTACCTACGATTTCTCGGGTTGGACCTGTACCGGTTTGGAACATATCGGCCAATGACGAACATTTTCATGGTTCAGGTTGGG
CGTGTACCTAGTTGCCTCTAATTGGACAGAAATATCCAATCGCCATGCGTTAATTATTTTCATCCAATGAAATATAAGCCCTGTGATGGATTTAGACCAA
TGCGCATGCCTGAATAGTTTTCAAGGTACTGCTTGGAGCCGTATCGGTTGTGATCAGATTTCACTGTCATTTTCATAGGTACTAAAGCGGGGGGTATACG
GTAGTACTTAAGTATATATTTGTGCCGACACTATATTGTAAAAATTCGTTATAAACTTCCAAACTTCGCGTGGTTTGTCTATTCAATATTGAATCACGCT
GGAGTTCTGATTGGTCGAATATACTTGTCCTTTCTGTAAGCGCCAATCAAATCTACTCAAAAATGGATTAGCCAATAGCGTCGATTCGTGATTCGATTCG
ACGGGGTCTGGAAATTCATACCGAATCCACAATAACAACAGCCAGTATATTCACGAGCCACTGCTGTGACGACTGTAGCACCGGTACACTGTAC