Description :
From Genome Similarity Track
Location :
Scaffold_353:17241- 18846
Transcript NameFunction/comments
Phypl_g7342hypothetical protein PHYSODRAFT_331251
Phypl_g7343hypothetical protein

Sequence
1605 bases(100 bases per row)
CTAGGAATCCAACACCGGCGTATTGTGCGAGCAGTCCGATGCActccttggacagcagcgtaAGCGGTTTTCCCTCGCGCAGGGCACCATTCTCGAGCTC
CGGGTCGATGATCTTGCCTGGAGCTCCAGGTTCGAGTACGCGGTTCCGCTCTGTGTAGGCCTGAGATCCGATAGCCGGCTCGGTCGGTCTTCCAGCACCG
CCTTAACGGTGTCGTCTGTCATCGTCATTCTTCAAACAACGGCTTCGCAACCGAGTGTTTGTGTCTTGAAGCAGGCGAATTGCGTAATGAGCAAGGGCGT
TGGCGCAACCCACCACCAGGATACGCCACTGTACCCTCTGCAGTGATCACGTGTGGCTGCGCCTTCGGACAACCTTGAACGTGGTTGCTGATCGTGAAAG
GGTGGCCGTGCACCGTCCACCATCGATCTCGCGTTGTTCTTTGCGTTGCAGCATTGCGGACTTTTGGCCCCCCACGCTGCATGCTGCCAGCATTGCCGTC
GTCGGAGAGGCGATGGGAGTCAACTTGTCCAGGTGCGAGTTGAGCTCCGACGGCGGGGAGGCAAATCGCTCGAGATTAATTAATTAATCCAGTGGCCACG
GACTCAGCCGTCGGATTCTTATATGTAGGAGAGGCTCacgctgcaagttgcaacaGTGCAGCCTGCAGGTGAGGAAGGAAGAGGATTTGGACTTGGTGCC
TCGCTCACAAGTGAAACCATCCGACGACGGCTTAGCGTGCCAAAATGGGAGCGtcggacgagcagcagcagctcgtactACACGTGAAGGTGGACCCGAT
CAACTATGGCGCCGTGCCGTCGGACGCGCCCCCGACGTCGCCCAAAACTTGCGATGACGGACTCGAAGACGACGTGCAGAGAGCTGGACCGCCGCCGAGA
CTGCTGTCGCCCGAGGTCTTGGCGTTGCTCATGCAGTACGCCGGAATCGGTTTCGTCAATGGAGTTCTCCCCGCTGTCATCTACCCGGTCTTGCAGGGAT
ACCTAATGCGGAAGGAACGACCGTCGTGTCCGCTACGGTGCTGGTACAGCTTCCCTGGCCGTACAAGATGTTCCTGGGGATTCTGAGCGACTGCTTCCCC
CTTGGGGGCTTTCGACGTCGACCGTACATGTTGCTGGGGGTGGctcttgtgctgctgtatGCTGTTCATGATCGCGAGCTTCCCTGAAGCTGCTCCGTAC
TACGGCGACCCCACCATGCACTCAAGCAGCCCCGATGAATGGACCGAAGCTCAGCGTCAGAGTATCAACCCCGACGCCCCCGACGCTGCAGGCAAATACG
TGATCCCCATGATGATGGCGTCGTTCGGGTATTTGCTggtcgaggtgctggccgacgctGTGGTGATCGAGTATGCGCAGCGCGAGCCAGCAAATACGCG
CGGGCGCATCCAATCGTGGATTCACAGCGTCCGCATGGGCTTCAATGCACTGGGCGCACTCGTGGTGGCAGTCGCGTTCAACGGCATCGAGTACGGCGGC
TCTTTTGACTTCTCGCTCACGTTTCCCCAAATGATGTTCATCCTGGGCTGTTTGTGCCTCCGCTTGGGCCTGCTGCCTGGTTCCTTATCTACGAAGACGA
GGTGC