Description :
From Genome Similarity Track
Location :
Scaffold_61:172408- 177252
Sequence
4844 bases(100 bases per row)
GCCACCAGAGTGTATCCTAATAGGCGAATTAGCTGGTAATCAGGATTATTCGTGCCTGCGAGGCACGCGGCTTTGACCTTTTGCACCATATCATCGACCT
CCTGGTGTTCGCGGATGACTGGTCCGTCCATCACGCATTCCGTTCGCTCGTTAGTAGCGTAGATTTCGTCGACCAATGCCGCGTCATTGCTTATAGCAAA
TCGCATCCTTGAGAAGACGTCGGCCCCAACATTTTTCACGCCCTTAATGTAATGCATTGTCATCCGGTATTCTGAGAGTAGTAACTTCCATCTCTTGACC
CGCAGGCTTGTTTCGGTCGGGAAGATTAAATTCTTGTGGTCCGTATGTACCACAATTGAGAAACCAAGAAGCATCGTGCGGTATTCTTTCAGTAGTTCGA
CCACGGAAAGCAACTCCAACTCCATGGTAGTGTAGTTCAGCTGATGCTTGTTCAGGCTACGAGAATAGCACGCGAGAATCTTAACGCCTTGCATTATCAG
TCCACCGAGCTGCGTACCGCTAGCGTCGGCGTAGACGTCAAACGACTTGTCGAAATCAGGAAACGACAGCAACACCGCTTCCGCAAAAGCACGCTGGATA
GCTCGGAAAGCCTTCGTATCACTGGACAGCCACGTAAAGGGCACTTAAAGCTTGTGAGCCGGTGCAGGGGCTTGCAGAGCGTTGTCTTATTGGGCACCAT
GTCCCTGTAGTAGTTTATCATACCGAGGAAGCGGCGGAGCTCTTTCCTGTTATTTGGTACGGCAATTCGCTGTATTGCCTGAATCGTTTTGGCCTGTGGC
CTTACGCCTTCAGCCGAGAGCGTGTATCCTAGGTAGGCGACCTCCTTGCGGAGTACATGACACTTCTTGCCGTTGAGCTAGACACCGAACGTATCCAAGC
GCTTGAACACAATACGCAGGTGCTCAAGATGTTCTTCTGCACTGGCGGAAAACACCAGGATGCCGTCTAAGTAAACCACGACAAATTCCAAATCACCAAA
GATTCTCTCCATACAGGCCTGGTATTCATCGGGAGCAGTAGAGATCCCCATCGGAAGACGCTTATACTGGAACTTGCACCATGGCAAACAAAATGCCGTA
AATGGGCGCATTTTCTTGCAAGTCGCCGTGCGTAGTATCCAAGATTAGCGTCGAATGTCGAAATACATTTCGCTTTAGAGAGTCGCATTAGTACCTCTCG
TATACGCGGCACGTAATACGGGCTTCGTCGAAGGAATTTGTTTAGCCATCGGTAGTCAGCCAGCAATCTCAAAGATCCGTCCGGCTTAACCAAGAAGAAA
GCAGGCGCCGCGACTTCACTGTCGTAGATCTGCTCCAGCACGTCAGTGGTGATCAGTTGCTGGATCTTCTCTCTTGCCTTCGCTTCATGGCTGCGTACAA
CAGTGTACGGCTTCGCGTACACCGGCTTATATCCAGGCGTAATAGGTATTTCGTAATCGTCGAAGCGCATGCGTCCAAGGTGGCCATCATATAACTTGCG
ATACTGGACGAGCAGCTCCAGGAAGCGTTGAGAAAGCTGGCCGTTCAATTCATCAGGAAGGAGTTGCTCAGGTTTGATCGACCCGTTGGCAACCTTTTTC
GACGCATCCGAGAATTCTTGGTCCTTCTTGACGTATACGGCCTCGTCCGTCGCGCTCTGGTATGTATTGAGACTGCGACTGCACTCATCCCACTGTACAA
CCTTGTTCTTGAAATTTAAAATGAGGCCGAGTGCGCTCATAAGGTCGCGTCCAATCACGATTGCGTCCTTGCTATCTTTAATTACCTCGAATTTATGCGT
GATAACCGAATCGGACTTGAGCTTCAAAAAAACAAATTGCACCATCGTAGAACCACTACTGGTGACCGAACCATTCATGGTCTCAAAGACAGTTGGTGAA
GCTGGAATAAACTTACGGCCTAGTTCCGTATTAGCACTAAGTGTCCCGCCGTTAATAATACTCTTAGAAGCTCCACTATCCAGCAAAGCTTCGAACGTCT
GCCCGCCTCGGCGGAGCTTTACTGGAATGCGCAGCGGCGCGCTCGTTGGTCTCGCCTTCGTCTCCAAAAGAACCACAACCTTTATCTCGCTCTCATCCCT
GTCCCACTCCGACTCGAAGTCCTTGTGGTTACGTGGATAGTGCTTCTTCTTGTTGGTTGTTTCCTCCGCAAGGAGGTCGACTACCTAGGATACACGCTCT
CGGCTGAAGGCGTGAGGCCACAGGCCAAAACGATTCAGGCAATACAGCGAATTGCCGTACCAAGTAACAGGAAAGAGCTCCGCCGCTTCCTCGGCCTGAT
AAACTACTACAGGGACATGGTGCCAAATAAGACAACGCTCTGCAAGCCCCTGCACCGGCTCACAAGCTCCAAGTGCCCTTTACGTGGCTGTCAAGTGATA
CGGAGGCTTTCCGAGCTGTCCAGCGTGCTTTTGCGGAAGCGGTGTTGCTGTCGTTTCCTGATTTCGACAAGCCGTTTGACGTCTACGCCGACGCTAGCGG
TACGCAGCTCGGTGGACTGATAATGCAAGGCGTTAAGATTCTCGCGTGCTATTCTCGTAGCCTGAACAAGCATCAGCTGAACTACACTACCATGGAGTTG
GAGTTGCTTTCCGTGGTTGAACTACTGAAAGAATACCGCACGATGCTTCTTGGTTTCCCAGTTGTGGTACATACGGACCACAAGAATTTAATCTTCCCGA
CCGAAACAAGCCTGCGGGTCAAGAGATGGAAGTTACTACTCTCAGAATACCGGATGACAATGCATTACATTAAGGGCGTGAAAAATGTTGGGGCCGACGT
CTTCTCAAGGATGCGATTTGCTATAAGCAATGACGCGGCATTGGTCGACGAAATCTACGCTACTAACGAGCGAACAGAATGCGTGATGGACGGACCAGTC
ATCCGCGAACACCAGGAGGTCGATGATATGGTGCAAAAGGTCAAAGCCGCGTGCCTCGCAGGCACGAATAATCCTGATTACCAGCTAATTCGCCTATTAG
GATACACTCTGGTGGCGTACCAGAAGCGTGTGATCGCTCCAGATAGCCTTCGTGACGATCTGATAGCTTGGTATTACCAGAATCTCGGACATCCTGCAGG
CGAGCGCCAGTTCAAGACCATGCGCCACACGCTCTACTGGCCTAATATGGAGACTAGCATCGTCAAGTTTGTTAAGAAGTGTACAGCCTGCAAGCGTGCC
AAGTTACATGGTGGAAAGCAAGACTTTGGTCTTTTACCGCCTCGCAGTATGAGAACGGTGAACCCATTTGACGTTGTGCATGTTGATTTGATTGGTCCGT
ACGATGGTGGCAGCTATGGAATTACGATAGTTGATCAAGCGACCAGATGGCACGAAGTCGGTGTCCAACAGGACAAGTGGACGCTCACGACGGCGGAGAG
TTTCGACCGCGAGTGGCTGTGCCGCTATCCGCGACCACGTACTGTAATTCATGACCAAGGATCAGAGTTCACGGGCGAGGAATTTCAGGAGCTGCTACGG
AGCTACGGTATCAAGGCCAAGCCAATTACGACGAAGAACCCCCAGGCTAACGTGATATGTGGACGCGTCCACCTGGGAATTTTCAATGTGATCCGATGTC
ACGAGGGCGTCGACTAGAAAAAGTTATTTACTACGCAGCATTCGCTGTCAGGGCTAGCTACCACAGCATTCTCAACGCGTCTCCGGGGCAATTAATTTTT
GGCCAAGATATGATTTCGCGCCAATTGCATGACGCAAATTAGAGCTACATGTCCAAGCGCAGGTTCGAAGCTATTCTGATAATGATCGCGAAAAAGCCAA
AAGAATTGAGCATTTCTACCAGCCAGGAGACCAAGTGATGATCCGCGTCCACAAGCTGTTCCGTGTAAAGACCAAGCGCATCGCCGATGGGCCGTTTCCT
ATCCCGACGGTCCATGACAATGGCACCGTCACTGTCGACAAGGGAGCTTCGCAGCAACAGATTAGTATACGCCGTATTTTTCCGTGTTGACTATTATTGC
TTCATGGGGTGAGCATGACACGCCTGCGTGTGCGTGGACGAATCCTGCGAAGGAATCTCCAATACTTTATTGACTAGATTGATGGAGATTAAAAGATGGA
GACGTAGGATGAAGCAAGTTCTAGTGCATAGACAAGGTAGCCTTTTAATTCATTCTCACATTTACGGCAAGTCCCTCTCAAGCAAGGCCTTTCGGTTCCG
AGCACTCCTCTGCAAGCCACGAGTGTGTCATTTTGATAAATCAAAAATGACACACTGCGGAGACTCCGCACGTGGGCTACAGCAAGCTCACCAACTATGG
GCTACAGCAAGCTCACCAACAATGGGCTACAGCAAGCGAAACCGCACGCCGATGCTCAAGGCGAGCGACTAGCTGGACCGACGAAACTGGGCTAGGAGTA
AGATTAAACTACGGACTAATTGGGACCGTGTTGTATTCTCTGATGAGAAGAAGTTCAATATCGGTGGTCCAGACGGCCTAAAGTACAGCTGGTATGACCT
ACGCTGCGAAAAGGAGACCTACTTCAGTCGTCAAAACGGTGGGGGCTCTGTCATGATCTGGGGAGGTTTTTCCTCTCAAGGAAAACCCGATTTGGCTTTC
CTTATAGACCGCCAAAACTCATTCCACTACCAGGAAACGCTAGCTAACTACTTGATACCAATTAAAGAAGCGTTCCACGACGGGGACTACATCTTCCAGC
ACGACAATGCAATCATACACGCATCCAAAAGCAGGAAACCCTTCCTTGAGAGCTCCGAAATTGAGGTAATGGACTACCAGGCGCTATCCGCGGGACTAAA
TCCGATAGAGAACGTCTGGCTACCTTGCGCGAGACGATTACAGT